ID: 933956491

View in Genome Browser
Species Human (GRCh38)
Location 2:87376755-87376777
Sequence GGGGAGGTGGCCTGAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933956491_933956498 5 Left 933956491 2:87376755-87376777 CCAGGAACTCAGGCCACCTCCCC No data
Right 933956498 2:87376783-87376805 AGCCCTGCACTGTGTGCTCCAGG No data
933956491_933956502 23 Left 933956491 2:87376755-87376777 CCAGGAACTCAGGCCACCTCCCC No data
Right 933956502 2:87376801-87376823 CCAGGCATGTGCTGAGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933956491 Original CRISPR GGGGAGGTGGCCTGAGTTCC TGG (reversed) Intergenic