ID: 933973106

View in Genome Browser
Species Human (GRCh38)
Location 2:87486153-87486175
Sequence CGCCCACAGAGGCCGGCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933973099_933973106 0 Left 933973099 2:87486130-87486152 CCAACGCACGGTGCCCTCCGGGC No data
Right 933973106 2:87486153-87486175 CGCCCACAGAGGCCGGCGTCTGG No data
933973093_933973106 16 Left 933973093 2:87486114-87486136 CCCACGAAGGCCTGCACCAACGC No data
Right 933973106 2:87486153-87486175 CGCCCACAGAGGCCGGCGTCTGG No data
933973094_933973106 15 Left 933973094 2:87486115-87486137 CCACGAAGGCCTGCACCAACGCA No data
Right 933973106 2:87486153-87486175 CGCCCACAGAGGCCGGCGTCTGG No data
933973096_933973106 6 Left 933973096 2:87486124-87486146 CCTGCACCAACGCACGGTGCCCT No data
Right 933973106 2:87486153-87486175 CGCCCACAGAGGCCGGCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933973106 Original CRISPR CGCCCACAGAGGCCGGCGTC TGG Intergenic
No off target data available for this crispr