ID: 933974280

View in Genome Browser
Species Human (GRCh38)
Location 2:87495693-87495715
Sequence TCTTAGGCTGAGAACCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933974273_933974280 9 Left 933974273 2:87495661-87495683 CCAGTGGAGGCGTCACCAGCCCT No data
Right 933974280 2:87495693-87495715 TCTTAGGCTGAGAACCTCAAAGG No data
933974276_933974280 -10 Left 933974276 2:87495680-87495702 CCCTTTGTCCACCTCTTAGGCTG No data
Right 933974280 2:87495693-87495715 TCTTAGGCTGAGAACCTCAAAGG No data
933974274_933974280 -6 Left 933974274 2:87495676-87495698 CCAGCCCTTTGTCCACCTCTTAG No data
Right 933974280 2:87495693-87495715 TCTTAGGCTGAGAACCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933974280 Original CRISPR TCTTAGGCTGAGAACCTCAA AGG Intergenic
No off target data available for this crispr