ID: 933976772

View in Genome Browser
Species Human (GRCh38)
Location 2:87518417-87518439
Sequence GATAACAGACAGAAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933976772_933976776 1 Left 933976772 2:87518417-87518439 CCAGCAGCCTTCTGTCTGTTATC No data
Right 933976776 2:87518441-87518463 GGAACAGAAAGAGCACGATTTGG No data
933976772_933976779 13 Left 933976772 2:87518417-87518439 CCAGCAGCCTTCTGTCTGTTATC No data
Right 933976779 2:87518453-87518475 GCACGATTTGGGAGCTAGCTGGG No data
933976772_933976777 2 Left 933976772 2:87518417-87518439 CCAGCAGCCTTCTGTCTGTTATC No data
Right 933976777 2:87518442-87518464 GAACAGAAAGAGCACGATTTGGG No data
933976772_933976780 14 Left 933976772 2:87518417-87518439 CCAGCAGCCTTCTGTCTGTTATC No data
Right 933976780 2:87518454-87518476 CACGATTTGGGAGCTAGCTGGGG No data
933976772_933976778 12 Left 933976772 2:87518417-87518439 CCAGCAGCCTTCTGTCTGTTATC No data
Right 933976778 2:87518452-87518474 AGCACGATTTGGGAGCTAGCTGG No data
933976772_933976781 27 Left 933976772 2:87518417-87518439 CCAGCAGCCTTCTGTCTGTTATC No data
Right 933976781 2:87518467-87518489 CTAGCTGGGGAGCTTCCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933976772 Original CRISPR GATAACAGACAGAAGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr