ID: 933989230

View in Genome Browser
Species Human (GRCh38)
Location 2:87621760-87621782
Sequence CCTGATGAGCATCCAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933989230_933989237 6 Left 933989230 2:87621760-87621782 CCTTCCACTGGATGCTCATCAGG No data
Right 933989237 2:87621789-87621811 CCTCCCTCTGGATGCTGATGTGG No data
933989230_933989238 7 Left 933989230 2:87621760-87621782 CCTTCCACTGGATGCTCATCAGG No data
Right 933989238 2:87621790-87621812 CTCCCTCTGGATGCTGATGTGGG No data
933989230_933989239 8 Left 933989230 2:87621760-87621782 CCTTCCACTGGATGCTCATCAGG No data
Right 933989239 2:87621791-87621813 TCCCTCTGGATGCTGATGTGGGG No data
933989230_933989242 15 Left 933989230 2:87621760-87621782 CCTTCCACTGGATGCTCATCAGG No data
Right 933989242 2:87621798-87621820 GGATGCTGATGTGGGGAAAATGG No data
933989230_933989235 -6 Left 933989230 2:87621760-87621782 CCTTCCACTGGATGCTCATCAGG No data
Right 933989235 2:87621777-87621799 ATCAGGGGAAATCCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933989230 Original CRISPR CCTGATGAGCATCCAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr