ID: 933990402

View in Genome Browser
Species Human (GRCh38)
Location 2:87629801-87629823
Sequence GGCCTGCTGAGTCACACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933990402_933990409 23 Left 933990402 2:87629801-87629823 CCTGCAGTGTGACTCAGCAGGCC No data
Right 933990409 2:87629847-87629869 ACTAAAAACCAAAGGGTGGCTGG No data
933990402_933990408 19 Left 933990402 2:87629801-87629823 CCTGCAGTGTGACTCAGCAGGCC No data
Right 933990408 2:87629843-87629865 GAGCACTAAAAACCAAAGGGTGG No data
933990402_933990404 -6 Left 933990402 2:87629801-87629823 CCTGCAGTGTGACTCAGCAGGCC No data
Right 933990404 2:87629818-87629840 CAGGCCAACAGATGCTATCAGGG No data
933990402_933990407 16 Left 933990402 2:87629801-87629823 CCTGCAGTGTGACTCAGCAGGCC No data
Right 933990407 2:87629840-87629862 GAAGAGCACTAAAAACCAAAGGG No data
933990402_933990406 15 Left 933990402 2:87629801-87629823 CCTGCAGTGTGACTCAGCAGGCC No data
Right 933990406 2:87629839-87629861 GGAAGAGCACTAAAAACCAAAGG No data
933990402_933990403 -7 Left 933990402 2:87629801-87629823 CCTGCAGTGTGACTCAGCAGGCC No data
Right 933990403 2:87629817-87629839 GCAGGCCAACAGATGCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933990402 Original CRISPR GGCCTGCTGAGTCACACTGC AGG (reversed) Intergenic
No off target data available for this crispr