ID: 933992280

View in Genome Browser
Species Human (GRCh38)
Location 2:87642401-87642423
Sequence CCCCACCGGGACCCCTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933992280_933992286 16 Left 933992280 2:87642401-87642423 CCTTCACAGGGGTCCCGGTGGGG No data
Right 933992286 2:87642440-87642462 CAGCCCAAGCTCATCTAAGGTGG No data
933992280_933992289 20 Left 933992280 2:87642401-87642423 CCTTCACAGGGGTCCCGGTGGGG No data
Right 933992289 2:87642444-87642466 CCAAGCTCATCTAAGGTGGAAGG No data
933992280_933992285 13 Left 933992280 2:87642401-87642423 CCTTCACAGGGGTCCCGGTGGGG No data
Right 933992285 2:87642437-87642459 ACTCAGCCCAAGCTCATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933992280 Original CRISPR CCCCACCGGGACCCCTGTGA AGG (reversed) Intergenic
No off target data available for this crispr