ID: 933993028

View in Genome Browser
Species Human (GRCh38)
Location 2:87647259-87647281
Sequence CTGTCTCTGCAGAGGCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933993028_933993034 18 Left 933993028 2:87647259-87647281 CCAAGGGGCCTCTGCAGAGACAG No data
Right 933993034 2:87647300-87647322 AGGCAAACCTGTAGAGAGAGAGG No data
933993028_933993031 -2 Left 933993028 2:87647259-87647281 CCAAGGGGCCTCTGCAGAGACAG No data
Right 933993031 2:87647280-87647302 AGGTCCTCAAATTAAGAGCCAGG No data
933993028_933993039 27 Left 933993028 2:87647259-87647281 CCAAGGGGCCTCTGCAGAGACAG No data
Right 933993039 2:87647309-87647331 TGTAGAGAGAGAGGCTCTGGGGG No data
933993028_933993037 25 Left 933993028 2:87647259-87647281 CCAAGGGGCCTCTGCAGAGACAG No data
Right 933993037 2:87647307-87647329 CCTGTAGAGAGAGAGGCTCTGGG No data
933993028_933993038 26 Left 933993028 2:87647259-87647281 CCAAGGGGCCTCTGCAGAGACAG No data
Right 933993038 2:87647308-87647330 CTGTAGAGAGAGAGGCTCTGGGG No data
933993028_933993035 24 Left 933993028 2:87647259-87647281 CCAAGGGGCCTCTGCAGAGACAG No data
Right 933993035 2:87647306-87647328 ACCTGTAGAGAGAGAGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933993028 Original CRISPR CTGTCTCTGCAGAGGCCCCT TGG (reversed) Intergenic
No off target data available for this crispr