ID: 933995513

View in Genome Browser
Species Human (GRCh38)
Location 2:87665763-87665785
Sequence ATGAATAGACATATTGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933995513_933995515 2 Left 933995513 2:87665763-87665785 CCATTGTCAATATGTCTATTCAT No data
Right 933995515 2:87665788-87665810 GTATCCTGGAAGCCGTACTGAGG No data
933995513_933995516 3 Left 933995513 2:87665763-87665785 CCATTGTCAATATGTCTATTCAT No data
Right 933995516 2:87665789-87665811 TATCCTGGAAGCCGTACTGAGGG No data
933995513_933995519 28 Left 933995513 2:87665763-87665785 CCATTGTCAATATGTCTATTCAT No data
Right 933995519 2:87665814-87665836 ATGAAACAAGCAAAAGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933995513 Original CRISPR ATGAATAGACATATTGACAA TGG (reversed) Intergenic
No off target data available for this crispr