ID: 933996285 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:87672354-87672376 |
| Sequence | CTGAGTCTGAGCATCCATCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 933996282_933996285 | -9 | Left | 933996282 | 2:87672340-87672362 | CCTCCGAGTCACCTCTGAGTCTG | No data | ||
| Right | 933996285 | 2:87672354-87672376 | CTGAGTCTGAGCATCCATCTAGG | No data | ||||
| 933996281_933996285 | -8 | Left | 933996281 | 2:87672339-87672361 | CCCTCCGAGTCACCTCTGAGTCT | No data | ||
| Right | 933996285 | 2:87672354-87672376 | CTGAGTCTGAGCATCCATCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 933996285 | Original CRISPR | CTGAGTCTGAGCATCCATCT AGG | Intergenic | ||
| No off target data available for this crispr | |||||