ID: 933996285

View in Genome Browser
Species Human (GRCh38)
Location 2:87672354-87672376
Sequence CTGAGTCTGAGCATCCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933996282_933996285 -9 Left 933996282 2:87672340-87672362 CCTCCGAGTCACCTCTGAGTCTG No data
Right 933996285 2:87672354-87672376 CTGAGTCTGAGCATCCATCTAGG No data
933996281_933996285 -8 Left 933996281 2:87672339-87672361 CCCTCCGAGTCACCTCTGAGTCT No data
Right 933996285 2:87672354-87672376 CTGAGTCTGAGCATCCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933996285 Original CRISPR CTGAGTCTGAGCATCCATCT AGG Intergenic
No off target data available for this crispr