ID: 933996880

View in Genome Browser
Species Human (GRCh38)
Location 2:87676559-87676581
Sequence CTCCGGTGCTGTGTTTCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933996880_933996887 9 Left 933996880 2:87676559-87676581 CCCGTGGAAACACAGCACCGGAG No data
Right 933996887 2:87676591-87676613 TAAGAGACAACAGAGAGGAGTGG No data
933996880_933996886 4 Left 933996880 2:87676559-87676581 CCCGTGGAAACACAGCACCGGAG No data
Right 933996886 2:87676586-87676608 TGGGATAAGAGACAACAGAGAGG No data
933996880_933996888 26 Left 933996880 2:87676559-87676581 CCCGTGGAAACACAGCACCGGAG No data
Right 933996888 2:87676608-87676630 GAGTGGTGCTTCCTGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933996880 Original CRISPR CTCCGGTGCTGTGTTTCCAC GGG (reversed) Intergenic