ID: 934004035

View in Genome Browser
Species Human (GRCh38)
Location 2:87744349-87744371
Sequence TCCACTTCAGGTGAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934004032_934004035 5 Left 934004032 2:87744321-87744343 CCTAGGAAGTTGTGACTTGGCTG No data
Right 934004035 2:87744349-87744371 TCCACTTCAGGTGAGATGGAAGG No data
934004029_934004035 28 Left 934004029 2:87744298-87744320 CCAGCTTGCATGGACGTGCATCA No data
Right 934004035 2:87744349-87744371 TCCACTTCAGGTGAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934004035 Original CRISPR TCCACTTCAGGTGAGATGGA AGG Intergenic
No off target data available for this crispr