ID: 934010338

View in Genome Browser
Species Human (GRCh38)
Location 2:87812941-87812963
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 8, 1: 0, 2: 2, 3: 29, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934010338_934010342 -1 Left 934010338 2:87812941-87812963 CCATCCACTTGCCACTGACACAG 0: 8
1: 0
2: 2
3: 29
4: 238
Right 934010342 2:87812963-87812985 GGTCTTCAAAATCTGCATTTTGG 0: 7
1: 1
2: 6
3: 95
4: 1098

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934010338 Original CRISPR CTGTGTCAGTGGCAAGTGGA TGG (reversed) Intronic
901071190 1:6519549-6519571 CTGTGGCATTGGCATGTGGCTGG - Intronic
902238035 1:15070229-15070251 CTGTGTCAGAGGCTACTGGTGGG - Intronic
903025812 1:20429324-20429346 CTGTGGCACTGCAAAGTGGAAGG - Intergenic
905015223 1:34773499-34773521 CTGGGTCGGGGGCAAGGGGAGGG + Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905281957 1:36855032-36855054 CTGTGTCAGGGGCAAGAACAAGG + Intronic
907326910 1:53644208-53644230 CTGGGGCAGAGCCAAGTGGAGGG - Intronic
907832175 1:58075385-58075407 CTGTGTCACTTCCAAGTGGAAGG + Intronic
910569981 1:88689059-88689081 CAGTGACACTGGAAAGTGGAAGG + Intronic
910716338 1:90235696-90235718 CTATGTCTGTGGAAAGTGGAGGG - Intergenic
913241703 1:116835485-116835507 CTCTGCCAGTGGCAAATGGCAGG + Intergenic
915121379 1:153631626-153631648 CTGAGTCAGAGGCAAGGGGGTGG - Intronic
916368545 1:164061783-164061805 CTGTGTCAGTGGGAAAGGGGAGG - Intergenic
917208158 1:172600083-172600105 CTGTGCCTGTAGCAACTGGATGG - Exonic
917263781 1:173197674-173197696 CTGTTGCAGGGGCAAGGGGAGGG + Intronic
917685117 1:177407956-177407978 CTGAGACAGTGGCAAGTGAAAGG - Intergenic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
921577648 1:216855617-216855639 CTGAGTCTGTGGCACGTGGAAGG + Intronic
921892847 1:220370380-220370402 CTGAGCCAGTGGCAAGTGCTAGG + Intergenic
923540308 1:234884096-234884118 ATGTGACAGTGGCAGGTGAAGGG + Intergenic
924766768 1:247039761-247039783 CTGTCTCATTGGCAGGTGCAGGG + Intronic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1064776355 10:18782057-18782079 TTGTGTCAGGGACAAGTGGATGG + Intergenic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067159378 10:43810422-43810444 CTGAGTCAGTCACAGGTGGAAGG + Intergenic
1068901665 10:62276667-62276689 CTCTGCCAATGGCAAGTGGAAGG - Intergenic
1069550881 10:69363175-69363197 CTGTGTCACTGCCATGTGTAAGG + Intronic
1070468419 10:76749757-76749779 CTGTGTCTCTGACAAGGGGAAGG + Intergenic
1070543655 10:77435866-77435888 CTCTGTCACTGCCAGGTGGATGG - Intronic
1071280085 10:84093714-84093736 CTGTGTCAGCCCCAAGTGGCTGG + Intergenic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1074389017 10:113041472-113041494 CTGAGTCAGTGGCCAGAGCAAGG + Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1076093692 10:127712990-127713012 CTGTCGCAGTGGCAGGTGCATGG - Intergenic
1076566121 10:131400659-131400681 CTGTGGCAGTGCAAAGGGGAGGG + Intergenic
1077475852 11:2790131-2790153 CTGTCTCTGTGGCAGGTTGAGGG - Intronic
1079357757 11:19743973-19743995 CTGTATCTGAGGCCAGTGGAGGG - Intronic
1079787641 11:24694926-24694948 CTGTGTAGGGGGCAAGGGGAGGG + Intronic
1080769593 11:35328204-35328226 CTGAGTCAGTGGGAATAGGATGG - Intronic
1080967355 11:37228588-37228610 CTGTTTCAGAGGCAAGTGACAGG - Intergenic
1083369379 11:62166246-62166268 CTGTGTCAGGGCCAAGGAGATGG + Intergenic
1084689709 11:70718014-70718036 CTGGTACAGTGGGAAGTGGAAGG - Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1087428205 11:98016965-98016987 CTGTGTCAGTGGTAGCTTGATGG - Intergenic
1088830005 11:113528852-113528874 CTGAGTTAGAGGCAATTGGAAGG - Intergenic
1089618355 11:119707924-119707946 CAGTGGTAGTGGCAAGAGGAAGG + Intronic
1089781426 11:120875687-120875709 CTGTGTCATTGGCATGGGGGTGG - Intronic
1094447753 12:30550180-30550202 CTGTCTCAGTGGCAGGAGGCAGG - Intergenic
1098486757 12:71030422-71030444 CTGGGTGAGTGACACGTGGAAGG + Intergenic
1101083091 12:101208995-101209017 CTGTTTCAGTGGAAAGGGGGTGG + Intronic
1101673079 12:106894957-106894979 GTGAGTGAGTGGCAAGTGAATGG - Intergenic
1101944899 12:109129392-109129414 CTGTGTCACTGGCATGTGTGTGG - Intronic
1106396267 13:29383849-29383871 CTATGTAAGTGGCCTGTGGATGG - Intronic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1111256108 13:85670674-85670696 CTGTGTCCCTGGGAAGAGGATGG + Intergenic
1112300123 13:98222597-98222619 CTGTGACAGGTGCCAGTGGAGGG + Intronic
1113444664 13:110356187-110356209 GTGAGTCAGTGGGAAATGGAGGG - Intronic
1116021582 14:39468618-39468640 CTCTGCCTGTGGAAAGTGGAGGG - Intergenic
1116316934 14:43409052-43409074 ATGTGTCATTGGCAAGAGGACGG + Intergenic
1118380676 14:65215053-65215075 CTGCCTCTGTGCCAAGTGGAAGG + Intergenic
1118705689 14:68478205-68478227 CTGTGTCAGAGGGAGGTCGATGG + Intronic
1119107239 14:71936394-71936416 TTGTGTCAGTGGGCTGTGGAAGG - Intronic
1119872921 14:78032385-78032407 TTCTGTCACTGGCAAGTGAAAGG - Intergenic
1120316334 14:82898270-82898292 CTGACTCAGTGCCAAGTTGATGG - Intergenic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122575104 14:102737145-102737167 CAGGGTCACTGGTAAGTGGAGGG + Intergenic
1122947553 14:105020068-105020090 ATGTTCCAGTGGCAAGTTGAGGG + Intronic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1123929916 15:25161766-25161788 CTGTGTTATTGGCAGATGGAAGG + Intergenic
1127882380 15:63169717-63169739 TTGTGTCATAGGGAAGTGGATGG - Intergenic
1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG + Intronic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1137299458 16:47133720-47133742 CAGTGTGGTTGGCAAGTGGAAGG + Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141383415 16:83596692-83596714 GTAGGTCAGAGGCAAGTGGAAGG + Intronic
1141542423 16:84736086-84736108 GTGTGTGAGTGGCGAGGGGAGGG + Intronic
1141573763 16:84951100-84951122 CTGTGTCAGAGGCCAGCGGGGGG + Intergenic
1145067350 17:19770747-19770769 TTGTTTCAGTGGGAAGTGGGAGG - Intergenic
1146253589 17:31374042-31374064 CTGTTACAGTGGCCAGTGGTAGG - Exonic
1146263127 17:31434383-31434405 CAGGGAAAGTGGCAAGTGGAGGG + Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1152041328 17:77905839-77905861 CTGTGTGAGCAGCTAGTGGACGG - Intergenic
1153213078 18:2789412-2789434 CTGTGTCAAGGCTAAGTGGAAGG + Intronic
1153855835 18:9145632-9145654 CAGTGCCAGTGGCAAGAGGGTGG + Intronic
1155282194 18:24251017-24251039 CTGTGCCTGTGGAAAGGGGAGGG + Intronic
1155784898 18:29884015-29884037 CTGTGTCAGCAGCATGTGGCTGG + Intergenic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156619147 18:38828195-38828217 TTGAGTCAGTGGCATGGGGAAGG - Intergenic
1159948916 18:74464969-74464991 GTGTGTGTGTGGCAAGTGGGGGG + Intergenic
1160512337 18:79459555-79459577 CTTTGGCACTGGCAAGGGGAGGG - Intronic
1160857453 19:1223934-1223956 CTGTTTCAGCGGGAAGTGGTGGG + Intronic
1161570038 19:5025488-5025510 CTCTGGCTGTGGGAAGTGGATGG - Intronic
1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG + Exonic
1164139789 19:22448824-22448846 CTGCGTCAGTGGCAGATGGTAGG + Intronic
1164249211 19:23462273-23462295 CTCTCTCATTGGCAAGTTGAAGG - Intergenic
1166197724 19:41218020-41218042 CTGTGTGTTTGGCACGTGGAGGG - Intergenic
1166631704 19:44412464-44412486 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1202648540 1_KI270706v1_random:161179-161201 GTGTGACAGTAGCAAGTAGATGG + Intergenic
925545568 2:5012237-5012259 CTGTCTCAGTGACAAGTAGTAGG + Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926337266 2:11873579-11873601 CATTGTCAGTGGTAAGTGGAAGG - Intergenic
927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG + Intergenic
927620183 2:24647777-24647799 ATGTGAAAGTGGCAACTGGAAGG + Intronic
928185749 2:29109135-29109157 CCGTTTCAGTGGCAAGTGCTGGG + Intronic
928477848 2:31649333-31649355 ATGTGTCAGGAGCCAGTGGATGG - Intergenic
930102496 2:47614175-47614197 CTGTGTTAGTGGCCAGTTGCAGG - Intergenic
930819349 2:55629847-55629869 GGGAGTGAGTGGCAAGTGGAGGG - Intergenic
930944829 2:57061297-57061319 CTGTGCCTGTGGAAAGGGGAGGG - Intergenic
931333320 2:61311875-61311897 CTGAGACAGTGGCAAATTGAAGG - Exonic
931906982 2:66853191-66853213 CTGTGACAATGGGAAGCGGAAGG - Intergenic
931954062 2:67397877-67397899 CTGTGGCGGAGGCAAATGGATGG - Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934656989 2:96121586-96121608 CTGTGTAACTGGCATGGGGAGGG - Intergenic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937487775 2:122333915-122333937 ACCTCTCAGTGGCAAGTGGATGG + Intergenic
938052478 2:128187245-128187267 ATGTGTGAGTGGCTAATGGAAGG - Intronic
938541305 2:132286211-132286233 GTGTGACAGTAGCAAGTAGATGG + Intergenic
939037689 2:137151933-137151955 CTGTGTTTGTAGCTAGTGGAGGG + Intronic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
941099731 2:161282430-161282452 GTGTGACAGTAGCAAGTGGATGG - Intergenic
941794103 2:169581357-169581379 TTGTGTCAGTGGAAAGTGAGCGG - Intergenic
941967706 2:171315946-171315968 CAGTGTCATTGGCAAGTGCCTGG - Intergenic
945800052 2:214417677-214417699 ATGTGTCGGTGGAGAGTGGATGG + Intronic
946243131 2:218368846-218368868 CTGTGTCAGTGGGAACCGGGAGG - Intergenic
947810198 2:232999360-232999382 CTGGGTCAGAGACAAGGGGAGGG - Intronic
949032328 2:241802951-241802973 CTGTGCCAGGGGCCCGTGGAGGG + Intronic
1169667978 20:8060271-8060293 CTGTGTAATAGGTAAGTGGAGGG + Intergenic
1170548135 20:17452536-17452558 CTGTGTCAGTTTCAAGCGTAAGG + Intronic
1171870212 20:30519233-30519255 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1172588728 20:36102874-36102896 GTGGGTCAGTGCCAAGGGGAGGG + Intronic
1173021612 20:39272281-39272303 CCGTGTCAGTGGAAAGGGGTGGG - Intergenic
1173185247 20:40835585-40835607 CTGTGTCAGAGGCAGATGCATGG + Intergenic
1174637711 20:52016254-52016276 CTGTCTCAGTGCCAAGTGCAGGG + Intergenic
1175618710 20:60424875-60424897 TGGTGGCAGTGGCAAGGGGAGGG + Intergenic
1176603313 21:8811508-8811530 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1176677731 21:9795486-9795508 CTGTGTCCGTATCAAATGGAGGG + Intergenic
1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG + Intergenic
1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG + Intergenic
1180345598 22:11703065-11703087 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1180352117 22:11814247-11814269 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1180353365 22:11821306-11821328 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1180384874 22:12171051-12171073 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1180386091 22:12177819-12177841 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1183015617 22:34984066-34984088 GGGTGTCAGTGGGAAGGGGAGGG - Intergenic
1184398879 22:44262093-44262115 CTGTGTCAGCGGCGAGTGTCTGG + Intronic
949570219 3:5285378-5285400 CTGTGATATTGGCAACTGGATGG + Intergenic
952869510 3:37886004-37886026 CTGTGGCAGTGGGAAATGGAGGG - Intronic
952889625 3:38031325-38031347 CTGTGCCAGGGGCCAGAGGAGGG - Intergenic
953450308 3:42999961-42999983 CCGTATTAGAGGCAAGTGGAGGG - Intronic
953808470 3:46091956-46091978 CTGTGTCATTGCAAAGTAGAAGG + Intergenic
954219071 3:49141631-49141653 CTGTGTCCTTGGCAAGGAGAGGG - Intergenic
954325296 3:49860170-49860192 CTTTGCCAGGGCCAAGTGGAAGG - Exonic
955058652 3:55477523-55477545 CTGGGTCGATGGGAAGTGGATGG - Intronic
957216366 3:77324994-77325016 CAGAGTAAGTGCCAAGTGGAAGG + Intronic
959613922 3:108326016-108326038 CTGAGGCAGTGGCAAGAAGAGGG - Intronic
961036078 3:123642521-123642543 CTGTGCCAGTGACAGCTGGAGGG + Intronic
961450904 3:127001903-127001925 CTGGGTCAGTGGCCAGAGGCAGG - Intronic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
962872909 3:139513649-139513671 CTGTCTCAGTAGCAAGGAGAGGG - Intergenic
964203585 3:154145804-154145826 CTGTGTAAATGGCAATTTGAGGG + Intronic
965120414 3:164547481-164547503 AAGTGTATGTGGCAAGTGGAAGG + Intergenic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969233809 4:5851199-5851221 CTGTGTGAGTGGCATGCAGAAGG - Intronic
973374766 4:49279143-49279165 GTGTGCCAGTAGCAAGTAGATGG + Intergenic
973376567 4:49291184-49291206 GTGTGACAGTAGCAAGTAGATGG + Intergenic
973377487 4:49297336-49297358 GTGTGACAGTAGCAAGTAGATGG + Intergenic
973378405 4:49303472-49303494 GTGTGACAGTAGCAAGTAGATGG + Intergenic
973379752 4:49311891-49311913 GTGTGACAGTAGCAAGTAGATGG - Intergenic
973380655 4:49318031-49318053 GTGTGACAGTAGCAAGTAGATGG - Intergenic
973382645 4:49331098-49331120 GTGTGCCAGTAGCAAGTAGATGG - Intergenic
973386255 4:49516147-49516169 GTGTGACAGTAGCAAGTAGATGG - Intergenic
975375900 4:73645716-73645738 CTTGGCCTGTGGCAAGTGGAGGG - Intergenic
976318279 4:83682869-83682891 CTGTTTTAGTGGCAAGAAGAAGG - Intergenic
979633683 4:122932530-122932552 TTCTGTCAGTGACCAGTGGAGGG - Intronic
980410417 4:132410471-132410493 CTGTATCTGTGGCCAGTAGAGGG + Intergenic
980512501 4:133812465-133812487 TGGTGTCAGTGGCAAGGGAAAGG - Intergenic
981576725 4:146213414-146213436 CTGTGTCAGGACCCAGTGGAGGG + Intergenic
982683319 4:158458903-158458925 CTCTGTCTTTGGAAAGTGGAGGG - Intronic
982740788 4:159054821-159054843 CTATGTGAGTGGCAAGGGGCAGG - Intergenic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
984219213 4:176952895-176952917 CTATGTCAGTGGCAAATTGTAGG - Intergenic
985397801 4:189563307-189563329 CTGTGTCCGTATCAAGTGGAGGG - Intergenic
989568708 5:42925471-42925493 CTGTGACAGTGGTCAGGGGAAGG - Intergenic
992744063 5:79801962-79801984 CTGACTCTGTGGCAAGGGGACGG + Intergenic
992894716 5:81236006-81236028 CTGTGCCAGTGTGAAGAGGAAGG - Intronic
993861804 5:93145399-93145421 CTGTGTCAGTGGGATGTACAAGG - Intergenic
998480372 5:142458289-142458311 CTGTGACAGTGGAAAGGGGAGGG - Intergenic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999977788 5:156929170-156929192 CCATGCCAGTGGCAAGGGGATGG + Intronic
1000289919 5:159860712-159860734 CTGTGTCTGTAGATAGTGGAAGG - Intergenic
1001106431 5:168858528-168858550 CTATGTAAGTGGCATTTGGATGG - Intronic
1001311702 5:170615643-170615665 CTGTTACCATGGCAAGTGGAGGG - Intronic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002913896 6:1513339-1513361 CTGTGTCAGTGGGGAGGGGTTGG - Intergenic
1003996396 6:11545165-11545187 CTGTGTCAGCAGCAAATGTAGGG + Intronic
1004282733 6:14294659-14294681 CTGTGCCTGTGGGAAGTAGAGGG - Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006901983 6:37508563-37508585 CTGTGAGAGAGGCAAGTGTAAGG + Intergenic
1007751105 6:44072621-44072643 CTGGGCCACTGGCAAGTGGGTGG - Intergenic
1007766933 6:44166157-44166179 TTGGGGCAGTGGCAAGAGGAAGG + Intronic
1008115603 6:47545867-47545889 CTCTGTCAGAGGGAAGTGTAGGG - Intronic
1010329223 6:74602654-74602676 CTGTTTCAATGTCAAGTTGAAGG - Intergenic
1010578230 6:77560839-77560861 TTGCTTCAGTGGCAAGTTGATGG - Intergenic
1012951002 6:105517956-105517978 CTGGGTCAGTAGCATATGGACGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014303976 6:119717090-119717112 CTGGGTCAGTGGAGAGTGGAGGG + Intergenic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1015948265 6:138524999-138525021 ATGTGTAAGTGGCAAATGGGCGG + Intronic
1016183074 6:141170944-141170966 CTGTGGCAGTGTCTAGGGGAGGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1019925997 7:4192160-4192182 CTGTGTCAGTTACAGATGGAAGG + Intronic
1026400569 7:70008495-70008517 CTGTGTCAGTGGCCTGTGTATGG + Intronic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027996168 7:85427517-85427539 CTCTGTCTGTGGAAAGGGGAAGG + Intergenic
1028491785 7:91420779-91420801 CTGCCTCGGTGGCAAGAGGATGG - Intergenic
1031737832 7:125389051-125389073 CTGAGTCAGAGGCAAGGAGAAGG - Intergenic
1031876522 7:127147968-127147990 CTGGTTCAATGGCAAGGGGATGG - Intronic
1032156091 7:129469499-129469521 CTTTGTCAGTGGGAGGTGGGTGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1045872199 8:106939754-106939776 ATGTGTCGGTGGCTGGTGGAGGG + Intergenic
1048426979 8:134332154-134332176 CTTTGGCAGTGGAAAGTGGGTGG - Intergenic
1048643800 8:136394913-136394935 CTGTTTCAGTGGGATGTGGGTGG + Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1050733926 9:8741509-8741531 CTGTTTGAGTGGAAAGTGGCTGG - Intronic
1051359914 9:16272817-16272839 CTGTGCCAGTAGCAAGTCTAGGG - Intronic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052847865 9:33353260-33353282 CTGTGTCAATGACAAATGGTAGG - Intronic
1053315874 9:37051506-37051528 CAGTATCAGCTGCAAGTGGAGGG + Intergenic
1053427140 9:38017535-38017557 CTCTGTCCCTGGCAAGTGGCTGG + Intronic
1055302108 9:74892447-74892469 CTCTGCCTGTGGCAAGTTGAAGG + Intergenic
1058175208 9:101727844-101727866 CTGTGTCTGTGGCCAGGTGAAGG + Intronic
1059052988 9:110948620-110948642 CTGTGTCAGTCCTAAGAGGAAGG + Intronic
1061274276 9:129560511-129560533 CTGGATCAGTGGCAAGAGGTGGG + Intergenic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1203698471 Un_GL000214v1:117248-117270 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203699389 Un_GL000214v1:123399-123421 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203700333 Un_GL000214v1:129682-129704 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203701255 Un_GL000214v1:135702-135724 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203480082 Un_GL000224v1:4285-4307 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203481052 Un_GL000224v1:10613-10635 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203482015 Un_GL000224v1:16922-16944 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203416733 Un_KI270330v1:322-344 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1203548581 Un_KI270743v1:150642-150664 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1203549838 Un_KI270743v1:157763-157785 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1203550777 Un_KI270743v1:163928-163950 GTGTGACAGTAGCAAGTAGATGG - Intergenic
1203568043 Un_KI270744v1:108393-108415 GTGTGACAGTAGCAAGTGGAAGG + Intergenic
1203569680 Un_KI270744v1:119636-119658 GTGTGACAGTAGCAAGTAGATGG + Intergenic
1186696326 X:12036865-12036887 CCGTGTCAATGGCATCTGGATGG - Intergenic
1186966124 X:14788046-14788068 CTGTGTCAGAGGAAAGTGCTAGG + Intergenic
1187521644 X:20019565-20019587 TTGTGTCAGTGACATGAGGAAGG - Intronic
1187579269 X:20591452-20591474 CTCTGCCAGTGGAAAGGGGAGGG - Intergenic
1188679331 X:32982539-32982561 CTGTTTTAGTGGGAAGAGGAAGG - Intronic
1192672932 X:73165726-73165748 CTGTGTCAGTGGGCTGTGAAAGG - Intergenic
1195280093 X:103324015-103324037 CTGTGTCAGTTTTGAGTGGATGG - Intergenic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1199684819 X:150256512-150256534 CAGTGCCAGTGGGAATTGGAAGG + Intergenic
1199853563 X:151741839-151741861 CAGTCTCAGTGGGAAGGGGAGGG + Intronic