ID: 934013262

View in Genome Browser
Species Human (GRCh38)
Location 2:87849668-87849690
Sequence AAGGCAAGTTACCATTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934013262_934013267 30 Left 934013262 2:87849668-87849690 CCAACCAAATGGTAACTTGCCTT No data
Right 934013267 2:87849721-87849743 TCCCCTTTATACTGACATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934013262 Original CRISPR AAGGCAAGTTACCATTTGGT TGG (reversed) Intergenic
No off target data available for this crispr