ID: 934020035

View in Genome Browser
Species Human (GRCh38)
Location 2:87939480-87939502
Sequence CTGTGTGACCAGATGGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934020035_934020039 8 Left 934020035 2:87939480-87939502 CCTAGCACCATCTGGTCACACAG No data
Right 934020039 2:87939511-87939533 TTTAGAACTACTGTAGCCTTGGG No data
934020035_934020040 13 Left 934020035 2:87939480-87939502 CCTAGCACCATCTGGTCACACAG No data
Right 934020040 2:87939516-87939538 AACTACTGTAGCCTTGGGATTGG No data
934020035_934020038 7 Left 934020035 2:87939480-87939502 CCTAGCACCATCTGGTCACACAG No data
Right 934020038 2:87939510-87939532 CTTTAGAACTACTGTAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934020035 Original CRISPR CTGTGTGACCAGATGGTGCT AGG (reversed) Intergenic
No off target data available for this crispr