ID: 934020039

View in Genome Browser
Species Human (GRCh38)
Location 2:87939511-87939533
Sequence TTTAGAACTACTGTAGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934020036_934020039 1 Left 934020036 2:87939487-87939509 CCATCTGGTCACACAGAGAAGTC No data
Right 934020039 2:87939511-87939533 TTTAGAACTACTGTAGCCTTGGG No data
934020034_934020039 9 Left 934020034 2:87939479-87939501 CCCTAGCACCATCTGGTCACACA No data
Right 934020039 2:87939511-87939533 TTTAGAACTACTGTAGCCTTGGG No data
934020035_934020039 8 Left 934020035 2:87939480-87939502 CCTAGCACCATCTGGTCACACAG No data
Right 934020039 2:87939511-87939533 TTTAGAACTACTGTAGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934020039 Original CRISPR TTTAGAACTACTGTAGCCTT GGG Intergenic
No off target data available for this crispr