ID: 934020040

View in Genome Browser
Species Human (GRCh38)
Location 2:87939516-87939538
Sequence AACTACTGTAGCCTTGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934020035_934020040 13 Left 934020035 2:87939480-87939502 CCTAGCACCATCTGGTCACACAG No data
Right 934020040 2:87939516-87939538 AACTACTGTAGCCTTGGGATTGG No data
934020034_934020040 14 Left 934020034 2:87939479-87939501 CCCTAGCACCATCTGGTCACACA No data
Right 934020040 2:87939516-87939538 AACTACTGTAGCCTTGGGATTGG No data
934020036_934020040 6 Left 934020036 2:87939487-87939509 CCATCTGGTCACACAGAGAAGTC No data
Right 934020040 2:87939516-87939538 AACTACTGTAGCCTTGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934020040 Original CRISPR AACTACTGTAGCCTTGGGAT TGG Intergenic
No off target data available for this crispr