ID: 934023199

View in Genome Browser
Species Human (GRCh38)
Location 2:87975747-87975769
Sequence AAGGCTTCTGGGAGACATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934023199_934023203 9 Left 934023199 2:87975747-87975769 CCATGATGTCTCCCAGAAGCCTT No data
Right 934023203 2:87975779-87975801 ACCCCCACAGCACTCAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934023199 Original CRISPR AAGGCTTCTGGGAGACATCA TGG (reversed) Intergenic
No off target data available for this crispr