ID: 934025746

View in Genome Browser
Species Human (GRCh38)
Location 2:88000335-88000357
Sequence ATGGCTCCTGCCCTTGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934025746_934025757 21 Left 934025746 2:88000335-88000357 CCCTGGACAAGGGCAGGAGCCAT No data
Right 934025757 2:88000379-88000401 TTTCCACTGTACTTTAGCCTGGG No data
934025746_934025756 20 Left 934025746 2:88000335-88000357 CCCTGGACAAGGGCAGGAGCCAT No data
Right 934025756 2:88000378-88000400 TTTTCCACTGTACTTTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934025746 Original CRISPR ATGGCTCCTGCCCTTGTCCA GGG (reversed) Intergenic
No off target data available for this crispr