ID: 934031822

View in Genome Browser
Species Human (GRCh38)
Location 2:88055456-88055478
Sequence TCCGGGGGCGGCGGCCGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 501
Summary {0: 1, 1: 1, 2: 2, 3: 41, 4: 456}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934031804_934031822 19 Left 934031804 2:88055414-88055436 CCCCTTCCCTCCGCACTCCACTC 0: 1
1: 0
2: 3
3: 110
4: 1219
Right 934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG 0: 1
1: 1
2: 2
3: 41
4: 456
934031817_934031822 -9 Left 934031817 2:88055442-88055464 CCCTGGCGTCTCTTTCCGGGGGC 0: 1
1: 0
2: 0
3: 9
4: 72
Right 934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG 0: 1
1: 1
2: 2
3: 41
4: 456
934031805_934031822 18 Left 934031805 2:88055415-88055437 CCCTTCCCTCCGCACTCCACTCG 0: 1
1: 0
2: 2
3: 21
4: 271
Right 934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG 0: 1
1: 1
2: 2
3: 41
4: 456
934031803_934031822 26 Left 934031803 2:88055407-88055429 CCGAGCGCCCCTTCCCTCCGCAC 0: 1
1: 0
2: 0
3: 24
4: 308
Right 934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG 0: 1
1: 1
2: 2
3: 41
4: 456
934031808_934031822 13 Left 934031808 2:88055420-88055442 CCCTCCGCACTCCACTCGGAAGC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG 0: 1
1: 1
2: 2
3: 41
4: 456
934031806_934031822 17 Left 934031806 2:88055416-88055438 CCTTCCCTCCGCACTCCACTCGG 0: 1
1: 0
2: 0
3: 14
4: 267
Right 934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG 0: 1
1: 1
2: 2
3: 41
4: 456
934031818_934031822 -10 Left 934031818 2:88055443-88055465 CCTGGCGTCTCTTTCCGGGGGCG 0: 1
1: 0
2: 2
3: 3
4: 53
Right 934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG 0: 1
1: 1
2: 2
3: 41
4: 456
934031810_934031822 9 Left 934031810 2:88055424-88055446 CCGCACTCCACTCGGAAGCCCTG 0: 1
1: 0
2: 2
3: 26
4: 279
Right 934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG 0: 1
1: 1
2: 2
3: 41
4: 456
934031812_934031822 2 Left 934031812 2:88055431-88055453 CCACTCGGAAGCCCTGGCGTCTC 0: 1
1: 0
2: 0
3: 21
4: 108
Right 934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG 0: 1
1: 1
2: 2
3: 41
4: 456
934031809_934031822 12 Left 934031809 2:88055421-88055443 CCTCCGCACTCCACTCGGAAGCC 0: 1
1: 0
2: 0
3: 7
4: 105
Right 934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG 0: 1
1: 1
2: 2
3: 41
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934031822 Original CRISPR TCCGGGGGCGGCGGCCGGTG AGG Intronic
900158813 1:1213878-1213900 TCCTGGGGAGGGGGCGGGTGAGG - Intronic
900438492 1:2642297-2642319 ACCGAGGGAGGAGGCCGGTGTGG - Intronic
901060961 1:6471724-6471746 TTCGGGGGCGGCGGCGGGTGAGG - Intronic
901242858 1:7704937-7704959 GTCGAGGGCGGCGGCCGGCGGGG + Intronic
901433861 1:9234668-9234690 TCCGCTGGCGGCCGCCGGGGCGG - Intergenic
901526222 1:9824577-9824599 TCCCGGGGCGGGAGCCGGTGTGG - Intergenic
903190254 1:21652109-21652131 ACGGGGGGCGGCGGCCGGGAAGG - Intronic
903498881 1:23791162-23791184 TCCGGCGGGGGCGGCCGAGGGGG + Exonic
903738202 1:25543673-25543695 AGCGGCGGCGGCGGCCGGAGCGG + Exonic
903907390 1:26696449-26696471 TCCGAGGGCGGCGGCGGCGGCGG - Exonic
903925227 1:26826914-26826936 GGCGGGGGCGGCGGGCGGCGCGG - Exonic
905145292 1:35883275-35883297 TGCGGGGGCGGCGGCGCGAGCGG + Exonic
905399876 1:37693226-37693248 TTGGGGGGCGGCGGGCGGGGCGG + Intronic
905670704 1:39788585-39788607 TCGGCGGGCGGCGGGCGGCGGGG + Exonic
905990663 1:42334908-42334930 TGCGGGGTGGGCGGCGGGTGGGG - Exonic
906321512 1:44820317-44820339 CCCGTGGGCGGCGCCGGGTGCGG + Intronic
906640562 1:47438396-47438418 CCGGGGGGCGGCGGCCGCAGCGG + Exonic
906704855 1:47887566-47887588 TCCTGGGGTGGGGGCCGGCGGGG + Intronic
907753019 1:57281790-57281812 TTCGGGGACGGGGGCCAGTGGGG + Intronic
908380643 1:63593962-63593984 TCCCGGGGCGCCGGGAGGTGCGG + Intronic
908501114 1:64744907-64744929 GCCGGGGCCGGGGGCCGGCGGGG + Intergenic
912174769 1:107141530-107141552 GCGGGGGGCGGCGGGGGGTGGGG - Intronic
914246125 1:145886867-145886889 TGCGGGGGCGGGGGCGGGGGGGG - Intergenic
914490007 1:148146136-148146158 CCCGGGGGCGCGGGCCGGGGTGG + Intronic
915070347 1:153261154-153261176 TCCGGCGGCGGGGGCGGGGGCGG + Exonic
915070479 1:153261637-153261659 TCCGGCGGCGGCGGCAGCGGCGG + Exonic
915325321 1:155078911-155078933 TCGGGGGGCGGCGGCGGCGGCGG + Exonic
915348194 1:155208716-155208738 GGCGGTGGCGGCGGCCGGAGCGG - Exonic
915495965 1:156282763-156282785 GCCGGTGGCGGCGGCGGCTGCGG - Exonic
920309968 1:205043242-205043264 TCCGGGTGCGGCGGCGGCCGCGG - Exonic
922166092 1:223117007-223117029 GCAGGGGGCGGCGCCCGTTGGGG + Intronic
923546405 1:234926813-234926835 TCCGGGGCAGGTGTCCGGTGGGG + Intergenic
924289721 1:242524713-242524735 TCCCGGGGCGGCGGCGGCGGCGG + Intergenic
924436877 1:244049447-244049469 CCCGGGGGAGGGGGCCGGCGGGG + Intronic
1062874223 10:931987-932009 GCCGGGGACGGCGGGCGGGGCGG - Intergenic
1062911459 10:1215058-1215080 TGCAGGGGCGGGGGCAGGTGCGG + Intronic
1063459110 10:6204114-6204136 GGCGGGGGCGGCGACCGGCGGGG - Intronic
1063660866 10:8034499-8034521 GACGGGGGCGGCGGAGGGTGTGG + Intergenic
1063995149 10:11611718-11611740 ACGGTTGGCGGCGGCCGGTGAGG - Intronic
1064410187 10:15097775-15097797 TCCAGGGGCGGCGTGCAGTGGGG + Intronic
1064981871 10:21173844-21173866 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1065140470 10:22714445-22714467 GCCGGCGGCGGCGGGCGGAGCGG - Exonic
1065161550 10:22927933-22927955 GCCGAGGGCAGCGGCCAGTGCGG - Intergenic
1065204459 10:23344112-23344134 TCCGTGGGCGGGGGCCGGGGAGG + Intronic
1066402606 10:35090350-35090372 GCCGGTGGCGGCGGCCGGCCGGG - Exonic
1067033808 10:42898503-42898525 ACCGAGGGCGGCAGCCTGTGTGG + Intergenic
1067068530 10:43116771-43116793 TCCGGGGCGGGGGGCGGGTGAGG + Intronic
1067096541 10:43305058-43305080 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1067336945 10:45374099-45374121 TGCGGGGGCGGGGGCGGGGGCGG + Intergenic
1067400669 10:45971074-45971096 TCCGGAGGCTGAGGCAGGTGAGG - Intergenic
1069991624 10:72319878-72319900 TTCGGGGAGGGCGCCCGGTGCGG + Intergenic
1070765427 10:79053516-79053538 TCGGGGGGCGGGGGGCGGGGAGG + Intergenic
1071086822 10:81875230-81875252 TCCGGCGGCGGCGGCGGGCTCGG - Intergenic
1072409068 10:95183871-95183893 GGCGGCGGCGGCGGCAGGTGCGG - Intergenic
1072710668 10:97713892-97713914 GCCTGGGGCGGCGGCTGGCGCGG - Exonic
1073196438 10:101695147-101695169 TCCCGGGGCGGCGGCGGTGGCGG - Exonic
1073266606 10:102231487-102231509 TCCGAGGGAGGGGGCAGGTGGGG + Intronic
1073325979 10:102644171-102644193 TCCGGCGGCGGCGGCAGCGGCGG - Intergenic
1073503924 10:103967351-103967373 TCCAGGGGCGGCGGCCACTCTGG - Exonic
1074864093 10:117535045-117535067 GCCGGGGGCGGGGGCAGCTGCGG + Intergenic
1076071372 10:127492595-127492617 GCGGGGGGCGGGGGGCGGTGGGG + Intergenic
1076554276 10:131311788-131311810 TCCGGGGGCGGCGGCGGCGCGGG - Intergenic
1076749747 10:132536939-132536961 TCCAGGGGAGGGGGCTGGTGCGG - Intergenic
1076947943 10:133664834-133664856 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076948933 10:133668144-133668166 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
1076949917 10:133671443-133671465 TCCGGGGGCGCGGGCTGGGGAGG - Intronic
1076950901 10:133674742-133674764 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076951891 10:133678052-133678074 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076952880 10:133681362-133681384 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076953864 10:133684661-133684683 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076954848 10:133741013-133741035 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076955837 10:133744323-133744345 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076956827 10:133747633-133747655 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076957814 10:133750942-133750964 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076958799 10:133754241-133754263 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076959788 10:133757551-133757573 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076960772 10:133760850-133760872 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076992098 11:280708-280730 CCCGGGGGCGGCGGCGCGCGTGG - Exonic
1076993760 11:288875-288897 TCCCGGGGCGGCTGTGGGTGGGG - Intergenic
1077124129 11:925067-925089 GCCGGGGGCGGCAGCCCCTGCGG - Intronic
1077152481 11:1078476-1078498 TCCCGGGCCGGCCGCCGGCGTGG - Intergenic
1077232090 11:1462290-1462312 CCCGGGTGCGGCGGCCGTGGGGG + Intronic
1077359304 11:2133703-2133725 TCCGGGGGCTGGGGTCAGTGCGG - Intronic
1082022475 11:47546262-47546284 GCCGGGGGCGGGGGCGGGGGAGG + Intronic
1082179630 11:49102416-49102438 TCCGAGGGCGGCAGCAGCTGTGG + Intergenic
1082928977 11:58579457-58579479 TGCGGCGGCGGCGGCCGCAGCGG - Exonic
1083625249 11:64069038-64069060 TCCGGGGGCAGTGGCAGGTGGGG + Intronic
1083941874 11:65900284-65900306 TCCGGGAACGGCGGCGGGTACGG - Exonic
1084153841 11:67303351-67303373 GCCGGGGGCGGGCGCAGGTGCGG - Intergenic
1084295907 11:68213375-68213397 GGCGGCGGCGGCGGCCGGTTGGG - Exonic
1084363691 11:68684672-68684694 TCCGGGTGCGGTGGCGGGTCTGG - Exonic
1084891002 11:72237221-72237243 TCCGGGGGCAGCAGCTGGTGCGG - Exonic
1085095997 11:73761036-73761058 TGCGGCGGCGGCGGCAGCTGTGG - Exonic
1086375425 11:86195209-86195231 TCCTGGGGCAGCGGTGGGTGCGG - Intergenic
1089432652 11:118436558-118436580 ACCGGGGGCGGCGGCGGCGGGGG + Exonic
1091225743 11:133955902-133955924 GCTGGGGGCGGCGGCGGGGGAGG - Intronic
1091567500 12:1659887-1659909 TCCTGGGGCAGAGGCCAGTGAGG - Intergenic
1092198996 12:6568355-6568377 TCCGGGTGCGGCGGCCGACTAGG - Intronic
1092246549 12:6867385-6867407 TCATCGGGCGGCGGCCGGGGCGG + Exonic
1094703998 12:32896964-32896986 CCCGGGGGCGGGGGCGGGGGCGG + Intergenic
1096389485 12:51217743-51217765 TCTGCGGGCGGCGGCCGCCGTGG - Intergenic
1096389595 12:51218101-51218123 GCCGGGGGCGGCGGGCTGGGAGG + Intergenic
1097035019 12:56118302-56118324 TACGGCGGCGGCGGCAGGTGAGG + Exonic
1100423410 12:94459802-94459824 TCCGAGGGCGGCGGCGGCGGCGG + Exonic
1103541465 12:121669305-121669327 TCCGGGACGGGCGGCCGGAGTGG - Intronic
1103564815 12:121810296-121810318 TCGGGGGGCGGCGGGCCGGGTGG - Exonic
1104889261 12:132132535-132132557 TCCGGGGGTGGCGGCTGCTCTGG - Intergenic
1104944168 12:132408269-132408291 TCCGGGCACGGAGGCCGATGGGG - Intergenic
1106340249 13:28820250-28820272 AGCGGGGGCGGCGGCCTGGGCGG + Intergenic
1110380218 13:74841724-74841746 GGCGGGGGCGGGGGGCGGTGGGG - Intergenic
1110558467 13:76886093-76886115 AACGGGGGCGGCGGCGGGGGCGG - Exonic
1112402106 13:99086438-99086460 GCCGGGAGCGGCGGGCGGAGCGG - Intronic
1113473284 13:110561769-110561791 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1115028393 14:28767466-28767488 TGCGGCGGCGGCGGCGGTTGCGG - Exonic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1116871478 14:50072824-50072846 TCGGTGGGCGGAGGGCGGTGGGG + Intergenic
1117920803 14:60723837-60723859 GGCGGCGGCGGCGGCCGGAGCGG - Exonic
1118220963 14:63853742-63853764 TGGAGGGGCGGCGGCGGGTGCGG + Intronic
1119392791 14:74302675-74302697 GGAGGGGGCCGCGGCCGGTGCGG + Intronic
1120881289 14:89416999-89417021 GCCCGGGGCGGCGGGCGGCGGGG + Intronic
1121342908 14:93115766-93115788 GGCGGCGGCGGCGGCGGGTGAGG - Exonic
1122108790 14:99480897-99480919 CCCGGGGGCGGGGTCCGGGGCGG - Intergenic
1122112122 14:99510288-99510310 GGTGGGGGCGGGGGCCGGTGTGG - Exonic
1122388648 14:101365425-101365447 TCAGGGTGAGGCGGCTGGTGGGG + Intergenic
1122470748 14:101964491-101964513 TGCGGCGGCTGCGGCCGGCGGGG + Intergenic
1122483610 14:102063678-102063700 TGGGGGAGCGGCGGCCGGTAGGG + Intergenic
1122620716 14:103056564-103056586 TGCGGGGGCGGGGGCGGGGGCGG + Intronic
1122697428 14:103562843-103562865 TGAGGGGGCGGCGGGCGGCGCGG - Intergenic
1122864457 14:104597247-104597269 TCCGGGGGGTGCTGCTGGTGGGG - Intronic
1123035496 14:105470223-105470245 GCGGGGGGCGGCCGCAGGTGGGG - Exonic
1123081503 14:105697523-105697545 GCCGAGGGCTGCGGCCGGTCGGG - Intergenic
1202853752 14_GL000225v1_random:37353-37375 TCCGGGGGCGCGGGCTGGCGAGG - Intergenic
1202854858 14_GL000225v1_random:43795-43817 TCCGGGGGCGTCGGCTGGCGAGG - Intergenic
1202868122 14_GL000225v1_random:136059-136081 TCCGGGGGCATGGGCTGGTGAGG + Intergenic
1123684353 15:22786689-22786711 GGCGGCGGCGGCGGCCGGGGAGG + Exonic
1123898065 15:24848235-24848257 GGCGGGGGCGGCGGCGGGGGCGG + Intronic
1125742130 15:41972570-41972592 TCCTCGGGCGGCGGCCAGCGCGG - Exonic
1126134677 15:45378585-45378607 GCCGCGGGGGGCGGCCGGGGCGG - Exonic
1128743697 15:70099385-70099407 TTCGGGGCTGGCGGCCGGAGCGG - Intergenic
1129189177 15:73927564-73927586 TCGGGGGGCGGCGGCGGCGGCGG - Exonic
1129503100 15:76059386-76059408 TCCGCGCGGGGCGCCCGGTGAGG - Intronic
1130115279 15:81000846-81000868 TCCGGGAGCGGCGGAGGGGGCGG + Intergenic
1130296018 15:82647598-82647620 CCCTGCGGGGGCGGCCGGTGGGG - Intronic
1130540371 15:84817422-84817444 TGCGGGGCCGGCGGTCGGGGAGG + Exonic
1131097439 15:89665556-89665578 CCGGGGCGCGGCGGCTGGTGCGG + Exonic
1131367734 15:91853933-91853955 TCGTCGGGCGGCGGCCGGAGCGG + Exonic
1132478623 16:154528-154550 TCCGTGGGCGGCGGGCGCTTGGG + Intronic
1132501407 16:286179-286201 TGCGGGGCCGGGGGCAGGTGGGG - Intronic
1132527729 16:425933-425955 TCAGGGCGCGGCGGCGGGCGCGG - Exonic
1132584679 16:700957-700979 TCCGGAGGAGGCGGCGGGGGCGG + Intronic
1132642743 16:985145-985167 GCCGGCGGGGGCGGCCGGGGTGG - Exonic
1132681844 16:1145685-1145707 ACCCGGGGCGGGGGCCTGTGCGG - Intergenic
1132712185 16:1273910-1273932 TCCAGGTGCGGCGGCCCGTGCGG + Intergenic
1132765842 16:1533813-1533835 TCCGGGCAGGGTGGCCGGTGTGG - Exonic
1132778888 16:1612365-1612387 TCCGGCTACGGCGGCCGGTGGGG - Exonic
1132871429 16:2117348-2117370 GCAGGTGGCGCCGGCCGGTGGGG - Intronic
1132937880 16:2490837-2490859 GCCGGAGGCGGTGGCCGGGGAGG - Intronic
1133053864 16:3135097-3135119 TTCGGGGGCGGGGGCGGGGGCGG + Exonic
1133053871 16:3135109-3135131 GGCGGGGGCGGGGGCCGGGGCGG + Exonic
1134053175 16:11151817-11151839 TCGGGGGGCGGGGGCCGGCTGGG + Intronic
1134419326 16:14071344-14071366 GGCGGCGGCGGCGGCCGGGGAGG + Intronic
1134521099 16:14919546-14919568 GCAGGTGGCGCCGGCCGGTGGGG + Intronic
1134550472 16:15136426-15136448 GCAGGTGGCGCCGGCCGGTGGGG - Intronic
1134708775 16:16318197-16318219 GCAGGTGGCGCCGGCCGGTGGGG + Intergenic
1134715989 16:16358231-16358253 GCAGGTGGCGCCGGCCGGTGGGG + Intergenic
1134950830 16:18350448-18350470 GCAGGTGGCGCCGGCCGGTGGGG - Intergenic
1134958767 16:18393928-18393950 GCAGGTGGCGCCGGCCGGTGGGG - Intergenic
1135115376 16:19718803-19718825 TGCTGGGGCGGGGGCCGGGGTGG + Intronic
1135135820 16:19884917-19884939 GCCGGGGGCGGGGGCGGGGGCGG - Exonic
1136226503 16:28863898-28863920 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1136365182 16:29806423-29806445 GCCGGGGGCGGGGGCCCGGGCGG - Intronic
1136547914 16:30965793-30965815 TCAGGGGGCGGCGGCCCATCAGG - Exonic
1137591998 16:49699480-49699502 GCAGGGGGCGGGGGACGGTGTGG - Intronic
1137673344 16:50291881-50291903 TCCGGGTGGGGCTGCAGGTGAGG + Exonic
1139473746 16:67192243-67192265 CCCGGGGGCGGCGGCGCCTGTGG - Exonic
1139484095 16:67246571-67246593 TCCGGGGGTGGGGGCGGGAGCGG + Intronic
1139534395 16:67562618-67562640 GGCGGCGGCGGTGGCCGGTGCGG + Exonic
1139678048 16:68539134-68539156 GCCGAGGGAGGCGGCCAGTGTGG - Intronic
1139826641 16:69762445-69762467 GCCGGGGGCGGCGGGCGGCGCGG + Intronic
1139917798 16:70438985-70439007 GGCGGCGGCGGCGGCCGGAGCGG - Intronic
1140087330 16:71808793-71808815 TCCGGGGGCGGCGGCAGCAGTGG + Exonic
1140223211 16:73058541-73058563 TCCGGCGGCGGCGGCTGCAGCGG + Intronic
1141083846 16:81077321-81077343 TCCGGCGGCAGCGCCCGGAGCGG - Intergenic
1141639885 16:85334973-85334995 TCCAGGGGTGGCGGGAGGTGAGG - Intergenic
1141957886 16:87384399-87384421 TGGAGGGGCGGCGGCCGGCGCGG + Intronic
1141959021 16:87392352-87392374 CCCGGGGGCGGCGGCTGCTGCGG - Exonic
1141989555 16:87602411-87602433 TCCGGGGGCGGGGGCGGGGGCGG + Intronic
1142209887 16:88803983-88804005 TCCGGGGGCGGCGGGCGGGCGGG - Exonic
1142336049 16:89490205-89490227 TCTGGGGGCGGTGGTCGGGGCGG - Intronic
1142553048 17:752525-752547 CCCGGGGGAGGCGCTCGGTGGGG - Intronic
1142586857 17:979450-979472 GCCGGGAGCGGGGGCCGGGGCGG - Exonic
1142631443 17:1229010-1229032 CCGGGGGGCGGCGGCCGCAGCGG - Intronic
1142683249 17:1562366-1562388 TCCGGGGCGGGCGGCACGTGAGG - Intronic
1142699303 17:1649642-1649664 GCCGGAGGCGGCGGCCGGGCTGG - Exonic
1142855033 17:2724478-2724500 TCCTGGGGAGGCGGCTGGCGCGG + Intergenic
1143078492 17:4365476-4365498 GCCCGGGGCGGCGGCCGGGTCGG - Intronic
1143189535 17:5031677-5031699 TCCCGGGCGGGCGGGCGGTGGGG + Intergenic
1143483098 17:7238415-7238437 GGGGGGGGCGGCGGCCGGAGAGG - Intronic
1143727621 17:8860281-8860303 TCCTGGGGCGGGGGGCGGTGTGG + Intronic
1143746940 17:9002116-9002138 TGTGGGGGCGGGGGGCGGTGGGG - Intergenic
1144109812 17:12020920-12020942 TCCGGGGGCGGCAGCGGCAGCGG + Exonic
1144113609 17:12063969-12063991 TCAGGGGGCGGGGGGCGGGGAGG + Intronic
1144339724 17:14301576-14301598 GGCGGGGGCGGCGGCGGCTGCGG - Exonic
1144782214 17:17813944-17813966 TCCCGGGCCGGTGGCGGGTGTGG - Intronic
1145018291 17:19412754-19412776 GCAGGGGGCAGCGGCCGCTGCGG - Exonic
1145190613 17:20840787-20840809 CCCGGGGGCGCGGGCCGGGGTGG + Intronic
1146371135 17:32266154-32266176 TCCGGGGGCGGCGGCGGCTGCGG - Exonic
1146403674 17:32519467-32519489 TCTGGCGGCGGCGGCGGGGGCGG + Intronic
1146646815 17:34581559-34581581 CCCGGGCGCGCAGGCCGGTGCGG + Intronic
1147123711 17:38351959-38351981 TCCGGGGGCCGCGGCGGGCGGGG + Intergenic
1147168554 17:38605570-38605592 GGCGGGGGCGGCGGCCGGGCCGG - Intronic
1147393127 17:40122213-40122235 TCCGGGGCGGGGGGCCGGGGCGG + Intergenic
1147486429 17:40819138-40819160 TCCGGAGGCGGCGGACGCGGCGG - Exonic
1147672394 17:42184181-42184203 GACGGAGGCGGCGGCCGGGGCGG + Exonic
1147764503 17:42824479-42824501 TCAGGGGGCGGCGGGCGCGGTGG + Intronic
1147996795 17:44363933-44363955 CCGGGGGGCGGCGGGCGGAGCGG - Intergenic
1148553507 17:48564427-48564449 GCCGGGGGCGGGGGCGGGGGCGG - Intronic
1148818459 17:50346734-50346756 CCGAGGGGCAGCGGCCGGTGAGG + Intronic
1148880152 17:50719487-50719509 TCCGGGGGCGGGGCCCGCGGAGG - Intergenic
1148945759 17:51260500-51260522 TTCGGCGGCGGCGGCCCGCGAGG + Intergenic
1149994703 17:61400347-61400369 GGCGGGGGCGGCGGCCGCGGCGG + Exonic
1150423092 17:65056247-65056269 GGCTGGGGCGGCGGCGGGTGCGG - Intronic
1152069869 17:78129117-78129139 TGCGGGGGCGGCGGGGGGGGGGG - Intronic
1152286480 17:79415924-79415946 TCTGGGGGCGTCTGCAGGTGAGG - Intronic
1152375481 17:79916718-79916740 CCCAGGGGCGGCGGCAGGAGGGG - Intergenic
1152642454 17:81454861-81454883 GTCGGGGGCTGGGGCCGGTGAGG - Intronic
1152744365 17:82032118-82032140 TCCGAGGGTGGCGGCAGGAGAGG - Intronic
1152852690 17:82647468-82647490 TGCGGGGGATGCGGCCGGGGCGG - Intronic
1152853499 17:82650408-82650430 GCCGGGGGCGGGGGCATGTGTGG + Intergenic
1153900493 18:9614171-9614193 TCCGCGGGGAGCGGCCGGGGAGG - Intronic
1155519588 18:26656038-26656060 TAGGGGGGCGGCGGCAGTTGGGG + Intronic
1156180464 18:34597762-34597784 TGGGGGGGCGGGGGGCGGTGGGG - Intronic
1156275715 18:35581467-35581489 AGCGGCGGCGGCGGCCCGTGCGG - Intronic
1156719188 18:40049182-40049204 TAGGGGGGCGGCGGAGGGTGGGG + Intergenic
1157383815 18:47246659-47246681 GCCAGGGGCGGCGGCGGGGGCGG + Intronic
1157582420 18:48781301-48781323 TCTGGGGGCGGCGGCTGGGAGGG + Intronic
1158435998 18:57435837-57435859 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1158976470 18:62715631-62715653 TCCGGAGGCAGCGGGCGGAGAGG - Exonic
1160029075 18:75243020-75243042 CCCGGGGGATGGGGCCGGTGAGG + Intronic
1160453342 18:78979744-78979766 CCCGGCGGCGGCGGCGGGGGGGG + Intergenic
1160499885 18:79396358-79396380 TCCGGGGGCGGAGGCCGCGCGGG - Intronic
1160587916 18:79922899-79922921 TCGGGGGCCGGCTGCCTGTGGGG + Intronic
1160860871 19:1236835-1236857 CGCGGGGGCGGCGGCCTGGGGGG + Intronic
1160862159 19:1242015-1242037 TCCGGGGGCGGCGGCCACGGAGG - Intronic
1160930458 19:1567625-1567647 TCGGGGGGCGACGGCCGGGGCGG + Exonic
1160996702 19:1885351-1885373 CCCGGGGGCGCGGGCCGGGGTGG - Exonic
1161057869 19:2199731-2199753 TCCCAGGGCTGCAGCCGGTGGGG + Intronic
1161256774 19:3314175-3314197 TGCGGGGGGGGGGGTCGGTGGGG + Intergenic
1161313141 19:3606221-3606243 TCAGGGGGCTGCAGCCGGGGAGG - Intronic
1161374710 19:3933512-3933534 CCCGGGGGAGGCGGCCCCTGGGG - Exonic
1161612488 19:5250936-5250958 TGCGGGGGCGGCGGGGGGGGGGG + Intronic
1161802634 19:6424547-6424569 CCCGGCGGCGGCGGCCCGGGCGG - Exonic
1161977192 19:7613198-7613220 GCCTGGGGCGGGGGCGGGTGGGG + Intronic
1161979753 19:7624271-7624293 TCTGGGGGCCCCGGCTGGTGGGG - Intronic
1162471021 19:10871975-10871997 GCCCGGGGCGGGGGCCGGCGGGG + Intronic
1162555707 19:11384244-11384266 GCCGGGGGCGGGGGACGGAGGGG - Exonic
1163026915 19:14517986-14518008 TCCGAGGGCGGAGGCCCGCGAGG + Intronic
1163106330 19:15125030-15125052 AGCGGGGGCGGCGGCCGCGGGGG + Exonic
1163146154 19:15380237-15380259 TCTGGGGGCGGCGGCGGTGGCGG + Exonic
1163743889 19:19033483-19033505 CGCGGCGGCGGCGGCGGGTGAGG - Intronic
1163851120 19:19664075-19664097 TCAGGAGGCGGGGCCCGGTGCGG + Intergenic
1164693132 19:30225732-30225754 CGGGGGGGCGGCGGCGGGTGGGG + Intergenic
1164989684 19:32674990-32675012 TCGGGGCGCGGCGGCCGGGCGGG - Intronic
1165121852 19:33565011-33565033 TGCAGGGGCGGCAGCCGTTGGGG + Intergenic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1165648998 19:37469332-37469354 TCCGGGGGCGGAGGCAGCTGAGG + Exonic
1166100389 19:40568111-40568133 CGCGGAGGCGGCGGCCGGAGCGG + Exonic
1166765589 19:45251134-45251156 TCCGGGGGCGGAGGCGGGTCTGG - Intronic
1166857930 19:45792499-45792521 TCCGGGGCCTGCGGGCGGCGGGG + Exonic
1166888062 19:45973467-45973489 GGCGGGGGCGGCGGCGGCTGCGG + Exonic
1167263053 19:48469736-48469758 TCCGGTGGCGGCGGGAGGGGCGG + Intronic
1167428807 19:49442898-49442920 TCCGGGGGCGGAGGCAGGACTGG - Intergenic
1167816628 19:51887949-51887971 TTCGGGGATGGCGGCCGGCGAGG + Exonic
1168076347 19:53982598-53982620 GCCGGGGGCGGCGGCGGAGGCGG + Exonic
1168643357 19:58044562-58044584 TCCGGGCGTGGCGGCCGCTCGGG - Intronic
925423120 2:3727583-3727605 TCCCAGGGCAGCGGCCAGTGAGG - Intronic
925984734 2:9206735-9206757 GCCGGGGGCGGCGGCCGGCCGGG - Intergenic
926130931 2:10302833-10302855 CCCGGAGGCGGGGGCCGGGGCGG - Intergenic
927053688 2:19351794-19351816 TCCGGGGGTGGGGGCAGGGGCGG + Exonic
927619215 2:24634709-24634731 TCCGGGGGCGGGGGGGGGGGGGG - Intronic
928412603 2:31066404-31066426 TGCGGGGGCGGGGGGCGGGGGGG + Intronic
928606358 2:32947622-32947644 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
929949293 2:46393934-46393956 TCCGGGGGTGGCGGGGGGGGGGG + Intergenic
930156417 2:48111736-48111758 GCCGGGGGCGCCGGCCGGGGAGG - Intergenic
930358224 2:50346885-50346907 CCCGGGGGCGGCGGCGGCGGCGG - Intronic
931611443 2:64105793-64105815 TCAGGGGGCGGGGGCAGGGGAGG - Intronic
933278224 2:80304622-80304644 GCGGCGGGCGGCGGGCGGTGGGG + Exonic
933791824 2:85889089-85889111 CCCGGGGGCGGGGGCCGCCGCGG - Intergenic
934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG + Intronic
934978346 2:98821931-98821953 TCGGGGGGCGCGGGCTGGTGCGG + Exonic
935250074 2:101253109-101253131 TCCGGGAGCGGAGGCCCGGGGGG + Exonic
935265162 2:101387425-101387447 GCCGCGGCCGGCGGCCGGCGCGG - Exonic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
937109244 2:119350062-119350084 TGGGGGGGCGGGGGGCGGTGTGG - Intronic
939085722 2:137716109-137716131 GCAGGGGGCGGCGCCCGCTGGGG - Intergenic
939629635 2:144516844-144516866 TCCCGGGGCGGGGGCGGGGGTGG - Intronic
940830086 2:158457070-158457092 TCCGGGGGCGGGGGCCGGTGGGG + Intronic
941020927 2:160407537-160407559 GCGGGCGGCGGCGGCGGGTGCGG + Intronic
941029313 2:160493443-160493465 TCCGGCGGCGGCGGCAGCGGCGG + Exonic
942511752 2:176709899-176709921 CCCAGGGGAGGCGGCCGCTGTGG - Intergenic
945466004 2:210171288-210171310 GGCGGCGGCGGCGGCCGGGGCGG - Exonic
946185498 2:217978563-217978585 CCCGGGGGCGGGGGCAGGGGCGG - Intronic
946340034 2:219060762-219060784 GCGGGGGGCGGCGGGCGGCGGGG + Intergenic
946692606 2:222320246-222320268 GCCGGGGGCGGGGGACGGGGAGG - Intergenic
1170226423 20:13995827-13995849 TCCTGGGGGTGCGGGCGGTGGGG + Intronic
1170756917 20:19212878-19212900 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1171120107 20:22560975-22560997 TCTGGCGGCGGCGGCACGTGAGG + Intergenic
1172587087 20:36092595-36092617 TCCGGGGGAGCCGGCCGGGGCGG + Intronic
1172771811 20:37386490-37386512 TCCGTGGGCGGCGGGCTGGGCGG + Intronic
1173495517 20:43514847-43514869 TTCGGGGGCGGGGCCCGGGGTGG + Intronic
1173822697 20:46029408-46029430 TCCGGGGGCGGCGGGGGAGGGGG + Intronic
1175215997 20:57391949-57391971 CCCGGGAGAGGCGGCAGGTGCGG - Intronic
1175813890 20:61873668-61873690 TGCGGGGGTGGCAGCCTGTGTGG + Intronic
1176382850 21:6121746-6121768 TCTGGGGGCGGGGGCAGGAGGGG + Exonic
1178440424 21:32593873-32593895 CCCGGCGGCGGGGGGCGGTGGGG - Intronic
1178992266 21:37366350-37366372 TGCGGGGGCGGCGGCGCGGGAGG + Intronic
1179561593 21:42219238-42219260 CCCGGGGGCGGCGGCGGCGGCGG - Exonic
1179740619 21:43416493-43416515 TCTGGGGGCGGGGGCAGGAGGGG - Exonic
1179891845 21:44339209-44339231 GCCGGGGGCGCCCGCCGGTCGGG - Exonic
1180096020 21:45555528-45555550 GCAGGGGGCGGCGGCGGGGGCGG + Intergenic
1180187240 21:46145823-46145845 CTCGGTGGCGGCGGCCGCTGCGG - Exonic
1180414189 22:12693680-12693702 TCCGGGGGCGTGGGCTGGCGAGG + Intergenic
1180979223 22:19870960-19870982 TCAGGGGGCTGCTGCAGGTGAGG + Intergenic
1181121670 22:20671203-20671225 CCCGGGGGCGCGGGCCGGGGTGG - Intergenic
1181574793 22:23787004-23787026 TGCGGCGGCGGCGGCGGCTGAGG + Exonic
1182415929 22:30221462-30221484 GCCGTGGGCCGTGGCCGGTGTGG - Intergenic
1182686194 22:32122895-32122917 TCAGGGGGCGGGGGCAGGTTGGG + Intergenic
1183466711 22:37983808-37983830 CCCGGGGGAGGCGGCCGAGGCGG - Exonic
1184034054 22:41910253-41910275 GCCGGGGGCGGGGCCCGCTGGGG + Intronic
1185258424 22:49849065-49849087 TCCTGGGGAGGTGCCCGGTGTGG + Intergenic
1185278667 22:49960751-49960773 CCCGGGCGAGGCGGCCGGGGCGG + Exonic
1185333360 22:50261352-50261374 GCCGGGCGGGGCGGCCGGCGGGG - Intronic
1185337153 22:50275853-50275875 CCCGGGGGCGGGGGCAGGTGGGG - Intronic
1185347409 22:50316676-50316698 TCCCTGGGTGGCGGCCGGTGGGG + Intronic
950004480 3:9682936-9682958 TCGGGGGGCGGGGGCGGGGGGGG - Intronic
951485285 3:23203232-23203254 GCCGGGGGCGGCGGCAGCGGCGG + Intronic
952744449 3:36764220-36764242 GCCGGGGGCGGCGGCGGCTGCGG + Intergenic
953326117 3:42013733-42013755 CGCGGGGGCGGCGGCCGGGTGGG - Intergenic
954632795 3:52056297-52056319 TTCGGGGGCGGCGGCGGCTGGGG - Exonic
954912481 3:54121703-54121725 TCCGAAGGCAGCGGCCGCTGGGG + Intergenic
955534000 3:59904078-59904100 TCCGGGGGCGGGGGGGTGTGGGG - Intronic
957083587 3:75658942-75658964 GCCGGGCGGGGCGGGCGGTGAGG + Intergenic
958894804 3:99817797-99817819 TCTGGGAGCGGCTGCCGGAGAGG + Intergenic
961674432 3:128555927-128555949 TCCAGGGGCGGGGGGCGCTGGGG - Intergenic
961858212 3:129893563-129893585 ACCGGGTGCGGCGGCCGCAGTGG - Intronic
962301790 3:134250298-134250320 TCCGGGCGCGGGGGGCGGGGAGG + Intronic
962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG + Intronic
962809029 3:138946247-138946269 TGCGCGGGCGGCGGCCGGAAGGG + Exonic
963081974 3:141402666-141402688 TCCGGGGCCCGCGCCCGGAGCGG + Intronic
963236738 3:142963696-142963718 TCCGGGGGCGGCGGCGGCGGAGG - Intergenic
963870529 3:150409724-150409746 TCCGGGGGCGGGGGCCGAAGTGG - Exonic
966874846 3:184315825-184315847 TCCGGGGGATGGGGCGGGTGGGG - Exonic
968462602 4:732831-732853 TCCGCGTGCGGAGGCTGGTGGGG - Intronic
968479331 4:826487-826509 CCCGGGGGCGGGGGCGGGGGTGG + Intergenic
968850577 4:3075024-3075046 GGCGGGGGCGGCGGCGGGGGCGG - Exonic
968907557 4:3461770-3461792 TGCGGAGGCGGGGGCCGTTGGGG - Intergenic
973916131 4:55636374-55636396 GCCGGGGGCGGCAGGCGGCGAGG - Intronic
977176842 4:93829011-93829033 TGCGGCGGCGGCGGCGGTTGCGG - Exonic
977536577 4:98261430-98261452 GCGGGGGGCGGCCGCCGGGGAGG - Intronic
978072584 4:104491453-104491475 GGCGGGGGCGGCGGCGGGGGGGG - Exonic
980075217 4:128287532-128287554 TCTGGGGGCCGGGGCCGGGGCGG - Exonic
981920505 4:150079590-150079612 GCTGGGGGTGGGGGCCGGTGGGG + Intronic
982042396 4:151409111-151409133 GGCGGGGGCGGGGGCCGGGGCGG - Intergenic
982712253 4:158769133-158769155 GCCGGGGGCGGCGGCCGCGGTGG - Exonic
983249285 4:165326892-165326914 CCCGGGGGCGGGGGCGGGGGCGG - Intergenic
983938233 4:173517841-173517863 TCCGAGGGCCGGGGCCGGCGAGG - Intergenic
983940037 4:173528705-173528727 CCAGGGGGCGGCAGGCGGTGGGG - Intronic
985445987 4:190021650-190021672 TCCGGGGGCGCGGGCTGGGGAGG + Intergenic
985452387 4:190068928-190068950 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
985453372 4:190072225-190072247 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985454362 4:190075518-190075540 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985455350 4:190078811-190078833 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985456337 4:190082111-190082133 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985457322 4:190085405-190085427 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
985458309 4:190088698-190088720 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985459298 4:190091998-190092020 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985463550 4:190174767-190174789 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985544861 5:504494-504516 TCCGGCGGCGGCAGCCAGGGAGG + Intronic
985865128 5:2508709-2508731 TCCGGGGGCAGCAGGGGGTGGGG - Intergenic
986733066 5:10649409-10649431 TCAGGGGGCGGCGGCAGCTCGGG - Exonic
986748094 5:10761384-10761406 GCCGGGGGCGGGGGCGGGGGCGG + Intergenic
990607128 5:57422532-57422554 TCCGGGGGGGTCGGCTGCTGCGG - Intergenic
990825437 5:59893366-59893388 GGCGGGGGCGGCGGCAGGGGGGG + Exonic
992105600 5:73447460-73447482 GGCGGCGGCGGCGGCCGCTGCGG + Exonic
992226218 5:74621671-74621693 GCCGGGGGCGGGGGGCGGGGGGG - Intergenic
992487418 5:77210358-77210380 TCCGGGAGCGGCGGGAGGGGCGG + Intergenic
992910724 5:81393923-81393945 TGCGGGAGCGGCGGCGGCTGGGG - Intronic
996404175 5:123090171-123090193 TCCGGGGGCGGGGGCGGCGGCGG - Exonic
996434821 5:123423014-123423036 TCCGGGGGCGAAGGCGGCTGGGG + Exonic
996862879 5:128084513-128084535 TCCGGCGGCGGCGGCGGCAGTGG + Exonic
999300109 5:150485871-150485893 CCCCGGGGCGGGGGCCGGGGCGG - Intronic
999727240 5:154446654-154446676 GCCCGGGGCGGCGGCAGCTGGGG - Exonic
999989135 5:157033569-157033591 GGCGGGGGCGGGGGCGGGTGGGG + Intronic
1002710968 5:181194899-181194921 TCAGGAGGTGGAGGCCGGTGAGG - Exonic
1003624137 6:7727223-7727245 TGCAGGGGCCGGGGCCGGTGCGG - Exonic
1003942707 6:11044464-11044486 TCCTGGCGCGGCGGCCGGCGAGG - Intergenic
1004216776 6:13711237-13711259 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1006327727 6:33366338-33366360 TCCGGCGGGGGCGGCCGAGGGGG - Intergenic
1007415832 6:41690759-41690781 CCCTGGGGAGGCGGCTGGTGGGG + Exonic
1007479746 6:42142269-42142291 TCCGGGGACGGAGGGCGCTGGGG - Intronic
1007795477 6:44343292-44343314 CCCGGGGGCGGGGGCAGGTGGGG + Intronic
1007902223 6:45422765-45422787 TGCGGCGGCGGCGGCGGCTGCGG + Exonic
1011129284 6:84037522-84037544 GCAGGGGGCGGCGCCCGTTGGGG + Intronic
1012400020 6:98835111-98835133 GGCGGGGGCGGCGGCGGGGGCGG + Exonic
1012475913 6:99614301-99614323 ACCGGGGGCGGCGGCAGCGGAGG + Exonic
1012895466 6:104941346-104941368 TGCTGGGTCGGCGCCCGGTGTGG + Intergenic
1015976436 6:138795992-138796014 TCCGGGCGCGGCGGCGGGAGGGG + Intronic
1016010750 6:139135501-139135523 GGCGGGAGCGGCGGCCGGGGGGG + Exonic
1017793624 6:157823033-157823055 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1018400493 6:163415142-163415164 TCCGGCGGCGGCGGCGGCGGCGG + Exonic
1018551297 6:165001673-165001695 TCAGGGGGCGGCGCTCGTTGGGG + Intergenic
1018757580 6:166863030-166863052 GCGGGGGGGGGCGGCCCGTGGGG + Intronic
1018818123 6:167351080-167351102 TCCGGGAGCGCAGGCGGGTGGGG + Intronic
1019343717 7:519916-519938 TCCGGGGGAGGCGGGGGGGGGGG - Intronic
1019509668 7:1411567-1411589 ATCGGGGGCGGCGGACGGGGTGG + Intergenic
1019529042 7:1494562-1494584 TCCGGGGGAGGCTGCGGCTGGGG + Intronic
1019536119 7:1530731-1530753 TGCGGTGGCGGCGGGCGGCGCGG + Exonic
1019989561 7:4682264-4682286 TCCGGCGGCGGCGGCTGCAGCGG - Intergenic
1020105324 7:5420061-5420083 TCCTGGGGCGGCCGCCGGGCAGG + Intronic
1020188319 7:5975260-5975282 TGCGGTGGCTGCGGCCGCTGAGG - Intronic
1020208567 7:6139815-6139837 TCCGGGCACTGCGGCCTGTGTGG - Intronic
1020294598 7:6749508-6749530 TGCGGTGGCTGCGGCCGCTGGGG + Intergenic
1021451255 7:20785341-20785363 TCCGGGGGCAGCGGCGGCGGCGG - Exonic
1022094479 7:27130300-27130322 TGCAGGGGCGGCGGCAGCTGGGG + Exonic
1022739725 7:33109416-33109438 TCCGGCGGCGGCGGCGGCGGCGG + Intergenic
1023881941 7:44325680-44325702 GCAGGGGGCGGCGGGCGGGGCGG - Intronic
1023937276 7:44748895-44748917 CCCCGGGGCGGCGGGCGGCGCGG + Intronic
1024520968 7:50304122-50304144 CGCCGGGGCGGCGGCGGGTGCGG - Intronic
1026025366 7:66740381-66740403 TCCTGGGGCTGCGGCCGCGGTGG - Intronic
1029370781 7:100149218-100149240 TCTGGGGGCAGGGGCCAGTGGGG + Intronic
1029459515 7:100686973-100686995 GCTGAGGGCGGCGGCCGGGGCGG - Intronic
1030176503 7:106660424-106660446 TCGGGGGGCGGCGGCGGTGGGGG + Exonic
1031966572 7:128031714-128031736 TCCGGGGGCGGGCGCGGGTCCGG + Intronic
1032021573 7:128409702-128409724 TCCGGGGCGGGCGGCCGAGGAGG - Intronic
1033159116 7:138981317-138981339 TCCGGGAGGGGCGGCCGCTGCGG + Exonic
1034415169 7:150960858-150960880 TTGGGGGGCGGGGGGCGGTGGGG - Intronic
1034426518 7:151016921-151016943 GCTGGGGGCGGGGGCTGGTGAGG + Intronic
1034501417 7:151453211-151453233 TCCAGGGGCTGCGGCAGCTGGGG + Intergenic
1034618070 7:152436022-152436044 GCGGGGGGCGGCGGGCGGGGCGG + Intergenic
1035013243 7:155739811-155739833 TGCTGGGGCGGGGGCTGGTGCGG - Exonic
1037887905 8:22604766-22604788 TCCGGTGGCGGCGGCAGCAGCGG + Exonic
1038311437 8:26449144-26449166 TGCGGGGGCCGCTGCGGGTGCGG - Intronic
1038807995 8:30812479-30812501 GCCGGGGCCGGGGGCGGGTGGGG - Exonic
1039476508 8:37841782-37841804 GGCGGGGGCGGCGGCCGGCGGGG + Exonic
1039798140 8:40932839-40932861 TGCGGGGGCGGCGGGCGGCGAGG - Intergenic
1040055861 8:43056422-43056444 TGCTGGGGCGGCGGTGGGTGCGG - Exonic
1042155692 8:65841974-65841996 TCCGGCGGCGGCGGCGGCGGCGG - Intronic
1042532666 8:69832083-69832105 GCCGGGGTCGGCGGCCCCTGTGG - Exonic
1044819324 8:96145155-96145177 TCCGGGGGCGGCGGTTGCTGGGG + Exonic
1045277482 8:100721319-100721341 TCGGGCGGCGGCGGCGGGCGGGG - Intronic
1045368009 8:101493872-101493894 TCCGAGGGCGGGGGCCGGCCAGG - Intronic
1045432142 8:102124143-102124165 GCCGGGGGCGGCTGCTGGGGGGG - Intronic
1047124777 8:121948342-121948364 GGCGGGGGCGGGGGGCGGTGGGG - Intergenic
1047300097 8:123606545-123606567 CCCTGGTGCGGGGGCCGGTGGGG + Intergenic
1048299154 8:133238851-133238873 TCCGGGGGCGGCAGCTGGGCAGG + Exonic
1048981169 8:139703914-139703936 TCCGGGGGCGGCGGGCGCGGCGG + Intergenic
1049240652 8:141535946-141535968 GGTGGGGGCGGCGGGCGGTGGGG + Intergenic
1049246728 8:141566872-141566894 TCCGGGGGCAGCGTCTGCTGTGG - Intergenic
1049405308 8:142449678-142449700 AGCGGCGGCGGCGGCCGGAGAGG + Exonic
1049462897 8:142738394-142738416 TCCGGGGGTGGGGGCGGCTGGGG - Intergenic
1049488436 8:142878543-142878565 TCCGGGGCAGGAGGCAGGTGGGG - Intronic
1049493332 8:142916563-142916585 TCCGGGGCAGGAGGCAGGTGGGG - Intronic
1050230895 9:3525500-3525522 GCCGGGGCCGGCGGGCGGCGCGG + Intronic
1051855473 9:21559824-21559846 CCCGGCGGCGGCGGCAGGTGTGG - Intergenic
1053399019 9:37801102-37801124 TCCCGGGGCGGAGGCAGTTGAGG - Exonic
1053690604 9:40584903-40584925 ACCGGGGGCGGGGGGCGGTTTGG + Intergenic
1054301861 9:63385874-63385896 ACCGGGGGCGGGGGGCGGTTTGG + Intergenic
1057488541 9:95505846-95505868 TGCGGAGGCGGCGGCGTGTGTGG - Intronic
1058885848 9:109320724-109320746 TCCCGGGCCGGCGGCCTGCGCGG + Exonic
1060477943 9:123999676-123999698 GCCGGGGGCGGGGGCGGGGGCGG - Intergenic
1060481374 9:124018433-124018455 GCAGGGGGCGGCGGCGGGGGAGG - Intronic
1060846214 9:126839507-126839529 CCCCGGGGTGGAGGCCGGTGGGG + Intergenic
1060974250 9:127755192-127755214 TGGGGGGGCGGTGGCCGGCGGGG + Intronic
1061559577 9:131394031-131394053 GGCGGGGGCGGCGGCAGGCGGGG + Intergenic
1062305998 9:135907419-135907441 GCCGGGGGCGGGGGCGGGCGCGG + Intergenic
1062358699 9:136177357-136177379 TCCAGGGAGGGCGGCCAGTGGGG + Intergenic
1062441343 9:136571059-136571081 TCCGGGGGTGACGGCAGGCGAGG - Intergenic
1062574553 9:137200194-137200216 GCCGCGGGCGGGGGCCGGGGCGG + Exonic
1062614832 9:137391572-137391594 ACCAGGGCCGGCGGGCGGTGGGG - Intronic
1062653426 9:137590120-137590142 TGTGCGGGCGGCGGCCGGGGCGG - Intronic
1203790738 EBV:150356-150378 TCGGGGGGCGGGCGACGGTGCGG + Intergenic
1186452927 X:9688139-9688161 TGCGGCGGCGGCGGCGGCTGCGG + Exonic
1186670024 X:11758414-11758436 ACCGGGGGCGGGGGCGGGGGCGG + Intronic
1187933102 X:24311731-24311753 TGTGGCGGCGGCGGCCGGTGGGG - Intergenic
1189137120 X:38561514-38561536 TCCGGCGGCGGCGGCGGCGGCGG - Exonic
1189350612 X:40272980-40273002 TCTGGGGGAGGTGGCCGGGGTGG - Intergenic
1189747226 X:44181709-44181731 TCCTGGAGCGGCTGCCTGTGTGG + Intronic
1190225222 X:48539863-48539885 TCAGGCGGCGGCGGCCGCTGAGG + Exonic
1192630956 X:72777488-72777510 TGCGGGGGCGGGGGGCGGCGGGG - Intronic
1192650753 X:72943313-72943335 TGCGGGGGCGGGGGGCGGCGGGG + Intronic
1197671591 X:129284088-129284110 TCTGGTGGAGGTGGCCGGTGGGG + Intergenic
1197871834 X:131068668-131068690 TCGGGGGGTGGGGGCGGGTGGGG - Intronic
1198370580 X:135985456-135985478 ACCGCGGGCGGCCGCCGGTGAGG + Exonic
1199772772 X:150984524-150984546 GCCGGGGGCGGCGGCGGTGGCGG - Intronic
1200092957 X:153644293-153644315 TGCGGGGGCGGGGGCGGGGGCGG + Intronic
1200092997 X:153644428-153644450 CCCGGGAGCGGCTGCCGGCGGGG + Intronic
1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG + Exonic
1201177107 Y:11315914-11315936 TCCGGGGACGTGGGCTGGTGAGG - Intergenic
1201178235 Y:11322551-11322573 TCCGGGGGCGCGGGCTGGCGAGG - Intergenic