ID: 934032844

View in Genome Browser
Species Human (GRCh38)
Location 2:88064084-88064106
Sequence CCGCAGGGCTGTGTTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934032839_934032844 11 Left 934032839 2:88064050-88064072 CCAGAAATGGACTTTACATGGCT No data
Right 934032844 2:88064084-88064106 CCGCAGGGCTGTGTTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934032844 Original CRISPR CCGCAGGGCTGTGTTCCCTC TGG Intergenic