ID: 934035078

View in Genome Browser
Species Human (GRCh38)
Location 2:88082473-88082495
Sequence GACAGGTGCAGAGCCAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 383}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934035078_934035080 2 Left 934035078 2:88082473-88082495 CCTCAGCTGGCTCTGCACCTGTC 0: 1
1: 0
2: 5
3: 41
4: 383
Right 934035080 2:88082498-88082520 TCCCCTTCCAGATGCCATGCTGG 0: 1
1: 0
2: 1
3: 16
4: 181
934035078_934035086 15 Left 934035078 2:88082473-88082495 CCTCAGCTGGCTCTGCACCTGTC 0: 1
1: 0
2: 5
3: 41
4: 383
Right 934035086 2:88082511-88082533 GCCATGCTGGGATCAGTGCTAGG 0: 1
1: 0
2: 2
3: 23
4: 228
934035078_934035090 29 Left 934035078 2:88082473-88082495 CCTCAGCTGGCTCTGCACCTGTC 0: 1
1: 0
2: 5
3: 41
4: 383
Right 934035090 2:88082525-88082547 AGTGCTAGGGATCAGGCTCAAGG 0: 1
1: 0
2: 2
3: 6
4: 138
934035078_934035091 30 Left 934035078 2:88082473-88082495 CCTCAGCTGGCTCTGCACCTGTC 0: 1
1: 0
2: 5
3: 41
4: 383
Right 934035091 2:88082526-88082548 GTGCTAGGGATCAGGCTCAAGGG 0: 1
1: 0
2: 0
3: 5
4: 112
934035078_934035089 22 Left 934035078 2:88082473-88082495 CCTCAGCTGGCTCTGCACCTGTC 0: 1
1: 0
2: 5
3: 41
4: 383
Right 934035089 2:88082518-88082540 TGGGATCAGTGCTAGGGATCAGG 0: 1
1: 0
2: 1
3: 11
4: 168
934035078_934035088 16 Left 934035078 2:88082473-88082495 CCTCAGCTGGCTCTGCACCTGTC 0: 1
1: 0
2: 5
3: 41
4: 383
Right 934035088 2:88082512-88082534 CCATGCTGGGATCAGTGCTAGGG 0: 1
1: 0
2: 0
3: 10
4: 155
934035078_934035082 3 Left 934035078 2:88082473-88082495 CCTCAGCTGGCTCTGCACCTGTC 0: 1
1: 0
2: 5
3: 41
4: 383
Right 934035082 2:88082499-88082521 CCCCTTCCAGATGCCATGCTGGG 0: 1
1: 0
2: 4
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934035078 Original CRISPR GACAGGTGCAGAGCCAGCTG AGG (reversed) Intronic
900166575 1:1246424-1246446 GGCAGGGACAGAGCCTGCTGGGG + Intronic
900500784 1:3003546-3003568 TCCAGTTGCAGAGCCCGCTGGGG + Intergenic
901646210 1:10718107-10718129 GCCAGGGGCAGGCCCAGCTGGGG + Intronic
902292724 1:15445763-15445785 GACAGGTGCAGGGACAGCTGTGG - Intronic
902604306 1:17560330-17560352 GACAGCTGGAGATCCAGGTGGGG - Intronic
902799012 1:18818057-18818079 CACGGGTGCAGACCGAGCTGCGG + Intergenic
903046279 1:20566503-20566525 GACAGGAGAAGGGGCAGCTGGGG - Intergenic
903136475 1:21312649-21312671 GACACGTGCTGTGTCAGCTGGGG - Intronic
903607515 1:24585695-24585717 GGCAGGGGAAGAGCAAGCTGTGG - Intronic
904318528 1:29681575-29681597 GCCAGGTGCAGGGACAGGTGGGG + Intergenic
904402479 1:30265917-30265939 GACAGGCGCTGAGCCTGCTGGGG + Intergenic
904844339 1:33397584-33397606 GACTGGTCCAGATTCAGCTGTGG + Intronic
904920576 1:34004866-34004888 GGCAAGTCCAGAGCCAGATGGGG - Intronic
905414504 1:37794793-37794815 GACAGGACCAGAGGGAGCTGGGG - Intronic
905815181 1:40944464-40944486 GGAAGGAGCAGAGCCAGCAGAGG - Intergenic
906054481 1:42904521-42904543 GAAAGGAGCAGAGCCAGAAGAGG + Intergenic
908822460 1:68102511-68102533 TGCAGGTCCAGACCCAGCTGGGG + Intronic
910470421 1:87547046-87547068 GCCAGGTGCATTCCCAGCTGTGG - Intergenic
911144374 1:94538575-94538597 GACTGTGGCAGAGCCACCTGAGG + Intronic
911504861 1:98736322-98736344 GCCATTTGCAGAGCCAGGTGGGG - Intronic
912585512 1:110761163-110761185 GATAGGTGCAAAGCCAGAGGTGG - Intergenic
913191415 1:116416325-116416347 GGCAGGAGCAGGGCCAGCCGTGG - Intergenic
913259924 1:116988683-116988705 GATAAGTGCAGAACCGGCTGTGG - Exonic
914049884 1:144122850-144122872 GTCATGTGCAGACCCAGCAGTGG + Intergenic
914129298 1:144842601-144842623 GTCATGTGCAGACCCAGCAGTGG - Intergenic
915245472 1:154553121-154553143 GAAAGAGGAAGAGCCAGCTGAGG - Exonic
915362530 1:155294758-155294780 GACATGGAAAGAGCCAGCTGCGG + Intronic
915367365 1:155323650-155323672 GACAGCAGCAGTGCCAGCTCGGG - Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
918405799 1:184210987-184211009 GACAGATGCAAAGGCAGATGAGG + Intergenic
919790972 1:201290714-201290736 GTCAGGCCCAGACCCAGCTGGGG + Intronic
920121963 1:203665468-203665490 GACAGGGGCAGAGACACCTGAGG - Intronic
920203564 1:204275550-204275572 GGTAGGTGCAGAGGCAGATGGGG + Intronic
920430093 1:205913349-205913371 GAGGGTTGCAGAGCCCGCTGTGG - Exonic
920516906 1:206591892-206591914 GACTGGTGGAGGGCCAGCCGGGG - Intronic
920657173 1:207885858-207885880 GACAGTGGCAGAGGCAGTTGGGG - Intronic
920665405 1:207959509-207959531 CCCAGGCGCAGACCCAGCTGCGG - Intergenic
922067737 1:222160181-222160203 GCCAGGAGCAGAGCCAGCTAGGG - Intergenic
922232818 1:223701241-223701263 GAGAGGGCCGGAGCCAGCTGGGG - Intergenic
922235272 1:223717838-223717860 GATAGATTCAGAGCAAGCTGGGG + Intronic
922526441 1:226308485-226308507 GAAAGGTCCACAGCCACCTGTGG + Intronic
923361488 1:233216137-233216159 GACAGTTGCTTAGCGAGCTGGGG + Intronic
924566897 1:245206285-245206307 TGCAGGTGCAGTGACAGCTGAGG - Intronic
1063191466 10:3698480-3698502 CACAGCTGCTGAGCCAGATGTGG - Intergenic
1063223483 10:3992747-3992769 GGCAGGTGCAGAGGCAGCCTGGG + Intergenic
1064139577 10:12778985-12779007 CACAGGTGCAGAGCAGGCAGGGG + Intronic
1064230968 10:13529012-13529034 GGCGGGTGCAGAGCCGGCCGGGG + Intergenic
1064352394 10:14588381-14588403 GATAGCTGCAAAGCCAACTGTGG + Intronic
1066493231 10:35915391-35915413 GACCTGTGCAGAGGCATCTGTGG + Intergenic
1066659494 10:37726561-37726583 GACAGGAGCAGCTCCCGCTGTGG + Intergenic
1067343240 10:45420727-45420749 GGCAGGAGCAAAGCCTGCTGAGG - Intronic
1068280016 10:54855372-54855394 GGCAGCTGCAGAGGCACCTGGGG + Intronic
1069921386 10:71817881-71817903 GACAGCAGCAGAACCAGCTGTGG + Intronic
1070651437 10:78239911-78239933 GAAAGGGGGAGAGCCTGCTGGGG - Intergenic
1070751556 10:78966977-78966999 GGCAGGAGAAGAGCCAGGTGAGG - Intergenic
1071285258 10:84138862-84138884 GATAGGTGAAGAGCTAGTTGTGG - Intergenic
1071336206 10:84602286-84602308 GAGAGGTGCAGAGAGAGGTGCGG - Intergenic
1072295287 10:94003668-94003690 GACAGGTGCAGCTTCAGATGTGG + Intronic
1072486844 10:95863941-95863963 GAGAGTTGCAGAGCAGGCTGTGG + Intronic
1073027242 10:100497052-100497074 GAGATGTGCAGAGCTAGCAGAGG - Intronic
1073180099 10:101578339-101578361 GACAGGAGCAGGTCCCGCTGGGG - Intronic
1076331978 10:129676554-129676576 GTCACGTGCAGAGCCTGGTGTGG - Intronic
1076353837 10:129838289-129838311 AACAGGTGCAAAGCCAACGGAGG + Intronic
1076807322 10:132865486-132865508 AACAGGTGCAGCGCCCGCCGGGG + Intronic
1076843310 10:133057113-133057135 GGCAGGTGCAGAGGCAGGTGAGG + Intergenic
1077197629 11:1289194-1289216 GGGAAGTGCAGAGTCAGCTGTGG - Intronic
1077790642 11:5436217-5436239 GACAGGTGCTGAGCCATAGGTGG + Intronic
1078762073 11:14259572-14259594 GACGAGTGCAGCGCCACCTGCGG + Exonic
1078934494 11:15939527-15939549 GTCAGGTGCAAAGCATGCTGGGG + Intergenic
1079100625 11:17539360-17539382 GAGAGGAGCAGACCCAGTTGGGG - Intronic
1080580629 11:33640371-33640393 GAGAGGTGCAGAAGCAGGTGTGG - Intronic
1081850014 11:46269045-46269067 GACAGAGGGACAGCCAGCTGAGG - Intergenic
1081907499 11:46679030-46679052 GCCAGGTTCAGAGCCCGCTGGGG + Exonic
1083131891 11:60632608-60632630 GCCAGCTGCAGTGGCAGCTGTGG - Intergenic
1083309845 11:61778523-61778545 GGCAAGTGGGGAGCCAGCTGGGG + Intronic
1083332323 11:61904722-61904744 GGCAGGGGCGGGGCCAGCTGGGG - Intronic
1083718037 11:64590480-64590502 GACAAGGGCAGGGACAGCTGTGG + Intergenic
1084189573 11:67492928-67492950 TACAGGCGCAGTGCCAGGTGAGG - Exonic
1084392987 11:68890788-68890810 GACAGGAGGAGGGACAGCTGGGG - Intergenic
1084972175 11:72777913-72777935 GACAGGCCCAGAGCAGGCTGAGG + Intronic
1085465172 11:76718170-76718192 GAGAGATGCAGAGCCAGGAGAGG + Intergenic
1088468266 11:110165195-110165217 GGCAGGTGCAGAGCCAGGTGCGG - Exonic
1088776185 11:113085630-113085652 GACAGCTGCAGAGTCCCCTGGGG - Intronic
1089357127 11:117861355-117861377 GACAGGTACAGAGCTGGCAGGGG + Intronic
1090534073 11:127621201-127621223 GGAAGGTGCAGAGACAGGTGAGG - Intergenic
1091223493 11:133944575-133944597 GGCTGGGGCAGGGCCAGCTGGGG - Intronic
1091626206 12:2122834-2122856 GACCGGTGCAGCGACCGCTGAGG + Intronic
1095857215 12:46873588-46873610 GAGAGGAGCAGAACCAGCAGAGG + Intergenic
1096626118 12:52897187-52897209 GACATTGGCAGAGCTAGCTGAGG + Intronic
1096749503 12:53749803-53749825 GTCAGGTGAGGACCCAGCTGGGG + Intergenic
1100963605 12:99989318-99989340 GCCAGGTGCAGGGTCACCTGTGG - Intergenic
1101395712 12:104345316-104345338 TGCAGCTCCAGAGCCAGCTGTGG + Intronic
1101442202 12:104712253-104712275 TCCAGGTGCACAGCCAACTGAGG + Intronic
1101758850 12:107642983-107643005 TACAGGTGCAAAGCCGGCTGGGG - Intronic
1101897346 12:108766694-108766716 CACAGGTGGAGAGCCAGCTGGGG - Intergenic
1102015375 12:109644773-109644795 GACAAGGGCAGTGCCTGCTGTGG - Intergenic
1102075347 12:110055614-110055636 AATTCGTGCAGAGCCAGCTGTGG + Intronic
1102221826 12:111200192-111200214 GGCAGGTGCAGATCCAGCTGTGG - Intronic
1103906533 12:124330523-124330545 GACATGTGCATCTCCAGCTGAGG + Intronic
1105278050 13:18947641-18947663 TACAGGTGTAGATGCAGCTGGGG - Intergenic
1105510229 13:21045641-21045663 GCCATGTGCAGAGGCAGCTATGG - Intronic
1105696897 13:22897859-22897881 GGCAGCTGCAGAGCCCGCCGAGG - Intergenic
1106253387 13:28001159-28001181 GCCAGGCGCAGAGCCAGGAGGGG + Intergenic
1106307048 13:28522046-28522068 CATAGGTGCACAGCCAGCTTCGG + Intergenic
1107405421 13:40107952-40107974 GAGGGGTGAAGAACCAGCTGGGG - Intergenic
1107597717 13:41980451-41980473 GACAGGTGCAGAGCTGACTGTGG + Intergenic
1108800863 13:54092883-54092905 GAGAAGTGCAGAGCCGGCAGGGG + Intergenic
1109243267 13:59918556-59918578 GCCTGATGCAGGGCCAGCTGTGG + Intronic
1110610388 13:77481065-77481087 GACAAGTGTAGAGACAGCTCTGG - Intergenic
1111654377 13:91133633-91133655 TACAGGTGAAGAAACAGCTGAGG + Intergenic
1114416230 14:22546366-22546388 GACAGTTGCTGAGCCAGCCCTGG - Intergenic
1117011317 14:51473394-51473416 GCCAGGGTCAGAGTCAGCTGAGG - Intergenic
1117389515 14:55249633-55249655 CACATGAGCAAAGCCAGCTGAGG + Intergenic
1119389107 14:74278307-74278329 GCCAGGTGAAGTGCCAGCTTTGG + Intergenic
1120054374 14:79905636-79905658 TACAGGTGCAGAGGAAGCGGGGG - Intergenic
1120813813 14:88832056-88832078 GGGAGGTGCAGAGACAGGTGAGG - Intronic
1121439970 14:93942379-93942401 GACCGGAGCAGATCCAGCTCAGG + Intronic
1121445337 14:93975150-93975172 GACGCAGGCAGAGCCAGCTGGGG - Intronic
1122541637 14:102501050-102501072 GACAGGTGGAGCCCCAGCAGGGG + Exonic
1122706671 14:103626266-103626288 GTCAGGTGCTGAGCAGGCTGTGG + Intronic
1123419752 15:20122099-20122121 GTCATGTGCAGACCCAGCAGTGG + Intergenic
1123446112 15:20331437-20331459 GTCATGTGCAGACCCAGCAGTGG - Intergenic
1123528974 15:21128635-21128657 GTCATGTGCAGACCCAGCAGTGG + Intergenic
1124606279 15:31172312-31172334 TCCAGGTGCAGAGCCAGAGGAGG - Intergenic
1125057209 15:35375593-35375615 GAAAGGAGGACAGCCAGCTGGGG - Intronic
1125773814 15:42192512-42192534 GGCAAGGGCAGAGCTAGCTGTGG - Intronic
1126375547 15:47993274-47993296 TCCAGGTGCAGAGCCGCCTGTGG - Intergenic
1126705931 15:51404950-51404972 GTAACTTGCAGAGCCAGCTGTGG - Exonic
1127311223 15:57753847-57753869 GACATTTGCAGAGTGAGCTGGGG + Intronic
1127671074 15:61195634-61195656 GACAGGTGGAAAGACTGCTGGGG - Intronic
1128565439 15:68697930-68697952 GGCAGGGACGGAGCCAGCTGTGG - Intronic
1128674961 15:69601937-69601959 TAAAGGTGGAGAGGCAGCTGGGG - Intergenic
1129692285 15:77720798-77720820 GGCAGCTGAAGAGGCAGCTGGGG - Intronic
1129828788 15:78653465-78653487 GACAGCTGGGGAGCCAGGTGAGG - Intronic
1131432078 15:92395135-92395157 GACAGGTGGGGAGGCAGCCGGGG + Intronic
1131455254 15:92578613-92578635 GACAGGGGCAGAGGAGGCTGGGG - Intergenic
1132359453 15:101200753-101200775 GACAGGTTCAGAGCAAGGTGAGG - Intronic
1132385705 15:101398480-101398502 GACATTTACAGTGCCAGCTGGGG - Exonic
1132855566 16:2043160-2043182 GAGAGCTGCAGAGCAAGGTGGGG - Intronic
1133077448 16:3290689-3290711 GGGAGGTGCAGAGGCAGCAGAGG + Exonic
1133222529 16:4324953-4324975 GGCAGGGGCAGGGCCTGCTGGGG - Intronic
1133648824 16:7790123-7790145 GGCAGGGACAGAGCCACCTGGGG - Intergenic
1134135154 16:11672712-11672734 GGCATGGGCAGAGCCAGATGTGG - Intronic
1135026944 16:19006031-19006053 GGCAGGGGCAGGGCCAGGTGGGG - Intronic
1135158493 16:20073770-20073792 GGCAGGTGCGGAGCGAGCAGAGG - Exonic
1136111131 16:28064013-28064035 GACAAGGGCAGAGCCTGCTGGGG + Intergenic
1136757298 16:32695438-32695460 GGCAGGGGCAGAGGCTGCTGAGG + Intergenic
1136810809 16:33174937-33174959 GGCAGGGGCAGAGGCTGCTGAGG - Intergenic
1136817285 16:33285017-33285039 GGCAGGGGCAGAGGCTGCTGAGG - Intronic
1136823848 16:33341546-33341568 GGCAGGGGCAGAGGCTGCTGAGG - Intergenic
1137232678 16:46582010-46582032 GACAAGTGGAGAGCCAGATGTGG - Exonic
1137433140 16:48434512-48434534 GACAGGGGAGGAGCCAGATGTGG - Intronic
1137599405 16:49745998-49746020 GACAGGTGCAGGGGGATCTGAGG + Intronic
1137985409 16:53103133-53103155 GACAGGGTCAGGGCCAGGTGGGG - Intronic
1138199242 16:55076947-55076969 GAGAGGTCCAGAGTCACCTGGGG + Intergenic
1138246465 16:55470571-55470593 GGGAGGTGCAGAGCCACCTGGGG - Intronic
1138577033 16:57914639-57914661 GACAGGACCATGGCCAGCTGTGG + Intronic
1139400738 16:66679475-66679497 CCCAGGAGCAGAGCCAGCAGAGG + Intronic
1141471525 16:84241808-84241830 GAGAGGTGGGGAGACAGCTGGGG - Intergenic
1141517264 16:84553924-84553946 GGTAGGTGCGGAGGCAGCTGTGG - Intronic
1141602788 16:85136647-85136669 GAGGAGTGCAGAGGCAGCTGGGG - Intergenic
1141702390 16:85648485-85648507 GCCACGTGCAGTGCCAGCTGGGG - Intronic
1141725027 16:85782302-85782324 GGCAGGGCCAGAGCCAGCAGTGG - Intronic
1141859990 16:86709993-86710015 GTCAAGGGCAGAGCCAGGTGGGG + Intergenic
1142068191 16:88074635-88074657 GACAGCTGGAAAGGCAGCTGGGG - Intronic
1142229105 16:88891307-88891329 GCTAGGTGCAGAGCCAGCGCAGG - Intronic
1142893970 17:2962915-2962937 GACAGCTTCAGAGCAGGCTGGGG + Intronic
1142998263 17:3774159-3774181 CACTGGGGCAGAGCCAGGTGAGG - Intronic
1143019653 17:3910569-3910591 GACAGGTGCGGGGGCAGCTCTGG + Intronic
1143163285 17:4885172-4885194 GACAGGTGAAGAGCTTCCTGAGG - Intronic
1143391027 17:6559337-6559359 GGCAGGAGCAGAACAAGCTGTGG - Intergenic
1143909355 17:10234963-10234985 GCAAGGTGCACAACCAGCTGTGG + Intergenic
1145901170 17:28491387-28491409 GGCAGGTACAGGGCCAGCTCTGG - Intronic
1146634831 17:34496229-34496251 GATAGATGCAGAGCCCTCTGTGG + Intergenic
1146657758 17:34645095-34645117 GACAGCTGCAGAGTCCCCTGAGG + Intergenic
1148111989 17:45149615-45149637 GACAGCAGCAGAGACAGCTGGGG + Exonic
1148197981 17:45728573-45728595 GAGTGGGGCTGAGCCAGCTGTGG + Intergenic
1148483528 17:47975941-47975963 GACAGGGACAGAGCCCTCTGTGG + Exonic
1148838058 17:50476821-50476843 GAAAGCTGCTGAGGCAGCTGGGG + Intergenic
1148861884 17:50608825-50608847 GACAGGTGCAGACGCATCTGGGG - Intronic
1149656522 17:58312154-58312176 GAGTGGTGCCCAGCCAGCTGCGG - Exonic
1152062332 17:78086955-78086977 GAGGGGTGCAGAGACAGGTGCGG - Exonic
1152631529 17:81412848-81412870 GACATATCCAGACCCAGCTGTGG + Intronic
1153178743 18:2408740-2408762 CACAGGTGCAGAGCTTCCTGAGG - Intergenic
1155176347 18:23304688-23304710 GACAGGTGCAGAGGAAGAGGGGG + Intronic
1156452706 18:37275470-37275492 GACAGGTGCGGAGAGAGCTGTGG + Intronic
1157923201 18:51734821-51734843 GAGAGGTGGACAGCCAGATGGGG - Intergenic
1158832580 18:61296546-61296568 GACAGGTGAAGAGACCGGTGTGG + Intergenic
1159409075 18:68046250-68046272 GACTGGAGCAGAGCCATTTGAGG + Intergenic
1159599953 18:70419469-70419491 AAAAGGTGCCGAGACAGCTGCGG + Intergenic
1159804775 18:72943001-72943023 GACAGGGCCAGAGGCAGGTGAGG - Intergenic
1159830460 18:73271905-73271927 GAAAGGTGCAGAGTCAACTTTGG + Intergenic
1160461957 18:79046282-79046304 GTCAGGTCCTGAGCCAGGTGGGG + Intergenic
1161499653 19:4606927-4606949 CACAGGTCCAGAGCCAGAGGTGG - Intergenic
1161650298 19:5480196-5480218 GGGAGGGGCAGAGCGAGCTGGGG + Intergenic
1161950909 19:7467374-7467396 AGAAGCTGCAGAGCCAGCTGCGG + Exonic
1162164557 19:8743447-8743469 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162165629 19:8750915-8750937 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162166694 19:8758371-8758393 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162167760 19:8765827-8765849 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162168699 19:8772125-8772147 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162170445 19:8784889-8784911 CACAGGTGCAGAACCAGCTCCGG - Intergenic
1162183815 19:8889142-8889164 GACAGGTGAAGAGCTAGGTTTGG + Intronic
1162555721 19:11384272-11384294 GGCAGCTGCTGACCCAGCTGTGG - Exonic
1162725008 19:12684969-12684991 GATAGGTGGAGAGGGAGCTGAGG - Intergenic
1162957623 19:14107868-14107890 GAGAGGAACAGGGCCAGCTGGGG - Intronic
1163844547 19:19630840-19630862 GACAGGTGCACAGTCAGTGGTGG - Intronic
1164858465 19:31543672-31543694 GACCTGTGCAGCCCCAGCTGAGG - Intergenic
1164911199 19:32013332-32013354 GAGAGGAGCAGAGCAAACTGGGG + Intergenic
1165732878 19:38157699-38157721 GACAGGATCAGGGCCTGCTGAGG + Intronic
1166434815 19:42758420-42758442 GACAGATGCAGGGCAATCTGAGG + Intronic
1167117139 19:47494877-47494899 GGCAGGTGCTGAGCCTCCTGTGG + Intronic
1167494600 19:49810191-49810213 GAAAGGGGCAGAGCCAGCTCTGG + Intronic
1168587448 19:57604883-57604905 GAGAGGTGCACAGCCAGCACTGG - Intronic
1202689273 1_KI270712v1_random:75413-75435 GTCATGTGCAGACCCAGCAGTGG + Intergenic
926008300 2:9389605-9389627 GACAGGGGCAGAGCCGTGTGAGG - Intronic
926051691 2:9749312-9749334 GAGAGGTGGAGAGAAAGCTGTGG + Intergenic
927092227 2:19720740-19720762 GGCAGGTGGAGAGCCACCTTGGG + Intergenic
927102903 2:19801498-19801520 GAGGGCTGCAGAGCCAGGTGTGG - Intergenic
927482531 2:23465598-23465620 GACAGGAGAAAAGCCAACTGAGG - Intronic
927780686 2:25937425-25937447 CTCAGCTGCAGACCCAGCTGGGG - Intronic
927861235 2:26561562-26561584 GACTGCTGCAGAGGGAGCTGGGG + Intergenic
929078217 2:38096004-38096026 GCCAAGTGCAGAGCTAGGTGGGG - Intronic
929092516 2:38233602-38233624 GCCAGTGGCAGAGCCAGATGTGG + Intergenic
929595547 2:43173481-43173503 CCAAGTTGCAGAGCCAGCTGGGG + Intergenic
930024145 2:47020232-47020254 GTCAGGTGCTGAGCCAGGAGTGG + Intronic
930768920 2:55112587-55112609 GACTGCTGCAGACACAGCTGAGG - Intronic
931640160 2:64374813-64374835 GACAGATGAAGAAGCAGCTGAGG + Intergenic
931960116 2:67473104-67473126 GAAAGGGGCAGAGCCAACTAGGG + Intergenic
932291809 2:70587595-70587617 GACATATGCAGAGGCTGCTGCGG - Intergenic
933957163 2:87380678-87380700 GTCATGTGCAGACCCAGCAGTGG - Intergenic
934035078 2:88082473-88082495 GACAGGTGCAGAGCCAGCTGAGG - Intronic
934241282 2:90272570-90272592 GTCATGTGCAGACCCAGCAGTGG - Intergenic
934271894 2:91544116-91544138 GTCATGTGCAGACCCAGCAGTGG + Intergenic
935066768 2:99655563-99655585 GACAGCAGCAGAGCAAGATGAGG + Intronic
935552003 2:104467504-104467526 CAGAGGTGAAGAGGCAGCTGTGG + Intergenic
935815528 2:106843210-106843232 CACAGCTGCTGTGCCAGCTGCGG - Exonic
936055418 2:109258606-109258628 GTTAGGAGCACAGCCAGCTGTGG - Intronic
936147880 2:109993727-109993749 GTCATGTGCAGACCCAGCTGTGG + Intergenic
936196811 2:110377720-110377742 GTCATGTGCAGACCCAGCTGTGG - Intergenic
937091218 2:119207654-119207676 GACAGCTGGAAAGGCAGCTGAGG - Intergenic
938555001 2:132416402-132416424 GGCAGCCGCAGAGGCAGCTGCGG - Intergenic
940783486 2:157958338-157958360 GAGAGGTGCAGAGCAAAGTGGGG + Intronic
941405108 2:165077699-165077721 CACAGATGAAGAGCCATCTGAGG - Intergenic
943692513 2:190882038-190882060 GGCACGTGTAGAGCCATCTGGGG + Intronic
943779489 2:191806298-191806320 AAGAGCTGAAGAGCCAGCTGAGG - Intergenic
946334883 2:219029933-219029955 GACAGGAGCAGCCCCTGCTGAGG - Intronic
946519714 2:220451532-220451554 GACAGGTGCTGACCGAGCTCTGG - Intergenic
946688046 2:222291232-222291254 GACTGGAGCAGAGGCAGCCGGGG - Intronic
948022083 2:234742336-234742358 GACTGGTGCTGAGAAAGCTGGGG + Intergenic
948405501 2:237715351-237715373 GACAGGTGCAAGGCCAGGCGGGG + Intronic
948921379 2:241067529-241067551 GACGGCTGCAGAGCCCGCTGTGG - Intronic
949005651 2:241645661-241645683 GACAGCTGGAGCGCCAGCTGTGG - Intronic
1168775047 20:440343-440365 ACCAGGTGATGAGCCAGCTGAGG + Exonic
1169130284 20:3163281-3163303 GGCAGGTGCTGAGCCACCTCAGG + Exonic
1169135400 20:3194215-3194237 CAGAGGTGCAGAGGCGGCTGAGG - Intronic
1169493249 20:6089296-6089318 GACAGTAGCAGAGCCAGGTGTGG - Intronic
1169761512 20:9100182-9100204 GGCAGGTCCAGAGCCACCTGTGG + Intronic
1170349676 20:15425079-15425101 GAAAAGTGCAGAGCCAACAGTGG + Intronic
1170546068 20:17436785-17436807 GACATCTACAGCGCCAGCTGGGG + Exonic
1170860222 20:20095783-20095805 GAGAGGATCAGAGCCAGCAGTGG + Intronic
1172174167 20:32962141-32962163 GACAGCGGCAGAGCCAGGAGGGG - Intergenic
1172176143 20:32972932-32972954 ATCAAGTGCAGAGCCACCTGGGG - Intergenic
1172435480 20:34926154-34926176 GGCTGTTGCAGAGGCAGCTGTGG + Exonic
1173549963 20:43925909-43925931 GACAGCTGCAGAGCAAGCTCGGG - Intronic
1174560938 20:51430191-51430213 CCTAGGTGCAGAGTCAGCTGGGG + Intronic
1174868836 20:54164692-54164714 GACCGGTGCAGAGAGAGCCGGGG - Intronic
1175416542 20:58805004-58805026 AACAGGTGCTGGCCCAGCTGAGG + Intergenic
1175465429 20:59187427-59187449 GACAGGTTCAGTGCCTGGTGAGG - Intergenic
1175590912 20:60191289-60191311 GAGAGAGGCAGAGCCAGCTAGGG + Intergenic
1175634170 20:60566746-60566768 GCCCAGTGCAGAGCCAGATGGGG - Intergenic
1177366982 21:20151904-20151926 TATAGGAGCAAAGCCAGCTGGGG - Intergenic
1178805855 21:35838408-35838430 GGAAGCTTCAGAGCCAGCTGTGG - Intronic
1178893845 21:36542838-36542860 GACAGGGGCAGGGGCAGGTGCGG - Intronic
1179289487 21:40006144-40006166 GACCAGAGCTGAGCCAGCTGAGG - Intergenic
1179621560 21:42619813-42619835 AAAAGCTGGAGAGCCAGCTGAGG - Intergenic
1180855904 22:19044581-19044603 GACAGCAGCAGAGCAAGCAGGGG + Intronic
1182344874 22:29655350-29655372 GACAGGGGCACTGCCAGATGAGG + Intronic
1182836115 22:33342717-33342739 GACAGATGCAGAGCGGGATGAGG - Intronic
1183313574 22:37124859-37124881 GACAGGAGCGGCACCAGCTGGGG - Intergenic
1183548884 22:38469554-38469576 GACAGGTACAGAGACAGTTCAGG + Intronic
1183956123 22:41381734-41381756 GACACGTGCGGGGCCAGGTGAGG - Intronic
1184134267 22:42537292-42537314 GACACGTGCAGCTACAGCTGTGG + Intergenic
1184232032 22:43163450-43163472 CACTGGCGCAGACCCAGCTGGGG + Intergenic
1184274680 22:43403700-43403722 GACAGCTGCAGGGCAGGCTGTGG + Intergenic
1184419614 22:44372064-44372086 GACAGAAGCAGGTCCAGCTGTGG - Intergenic
1184614121 22:45626341-45626363 GAGAGGGGCTGAGCCAGCCGTGG + Intergenic
1184959514 22:47918807-47918829 AACAGCTGCAGAGCCGGCTCCGG - Intergenic
1184997616 22:48221103-48221125 TATAGGTGAAAAGCCAGCTGAGG + Intergenic
1185121516 22:48974491-48974513 GACATGTGGGGAGCCAGCTGTGG + Intergenic
1185268565 22:49918056-49918078 GACAGGTCCAGCCCCAGGTGAGG + Intronic
949503172 3:4701472-4701494 GACAGGAGCAGAGGCAGCCCGGG - Intronic
950133760 3:10565940-10565962 GATAGGTGGATAGACAGCTGAGG - Intronic
950418155 3:12880391-12880413 TGCAGATGCAGAGGCAGCTGGGG + Intergenic
950768353 3:15290941-15290963 GACAGGGGAAGACACAGCTGAGG + Intronic
953572052 3:44078964-44078986 GAAAGGTGCAGAGGGACCTGAGG - Intergenic
953687453 3:45089163-45089185 GACAGATGAAGAGGCAGCTGGGG + Intronic
954149636 3:48650967-48650989 GACAGGGGCACTGCCCGCTGTGG + Exonic
954382126 3:50225107-50225129 GAGAGGGGCAGAGCCAACAGTGG + Intergenic
954883011 3:53848392-53848414 GACAGATGGAGACCCACCTGTGG + Intronic
955927558 3:64023067-64023089 GAGAGATGCAGACCCCGCTGAGG + Intronic
956750724 3:72342042-72342064 GAAAGGGTCAGAGCCATCTGGGG + Intergenic
957039598 3:75327149-75327171 GAGAGGGGCTGAGCCAGCAGAGG + Intergenic
960265808 3:115619658-115619680 GCCATGTGCAGAGGCAGCAGAGG + Intergenic
961034708 3:123634422-123634444 GACAGCTGCCCAGTCAGCTGAGG - Intronic
961137963 3:124529608-124529630 CCCAGGTGCACAGCCAGATGTGG + Intronic
961795262 3:129404283-129404305 GACCGGAGCAGAGCCAGATTCGG + Exonic
961916143 3:130376870-130376892 GACAGATGTAGACCCACCTGGGG - Intronic
961983408 3:131104929-131104951 GATTGGTGCAGAGCCAGAGGAGG - Intronic
962753358 3:138450766-138450788 GCCAGGTCCTGAGCCAGCTTTGG - Intronic
962971941 3:140409204-140409226 GGCTGGGGCAGAGCCAACTGTGG - Intronic
967117085 3:186351796-186351818 GACTGGTGCAGATCCAGTTTCGG + Intronic
967217256 3:187220968-187220990 GAGTGGTGCAGAGCCAGCAAGGG - Intronic
968046822 3:195628826-195628848 GAAAGGGGCAGAACAAGCTGGGG + Intergenic
968307833 3:197661218-197661240 GAAAGGGGCAGAACAAGCTGGGG - Intergenic
968451118 4:676501-676523 GACAGCTGCAGAGGCCCCTGCGG - Intronic
968451451 4:677863-677885 GACAGCTGCAGAGTGAGCTTTGG - Intronic
968874320 4:3257320-3257342 GACAGGTGCAGAGGCAGGTGTGG + Intronic
969137899 4:5045201-5045223 GAGAGGTACAGAGCCCGCTCAGG - Intergenic
969264204 4:6054567-6054589 GACAGAGGCCCAGCCAGCTGCGG + Intronic
969555013 4:7901627-7901649 GGCAGGTGCAGAGCCAGGGAAGG + Intronic
970839779 4:20453906-20453928 GAAAGTGGCAGAGCCAGATGTGG + Intronic
971366576 4:25982379-25982401 GGCAGATGCAGACCCAGCAGAGG - Intergenic
972638017 4:40901422-40901444 GAGAGATGCAGAGCCTGGTGGGG + Intronic
977360421 4:95997442-95997464 GAAAGGAGCAGAGCAAGCTCTGG + Intergenic
985009759 4:185570347-185570369 GACAGGTGCAGAGCATACGGTGG + Intergenic
985076242 4:186218109-186218131 AACAGGTGCAAAGCCAAATGTGG + Intronic
985476364 5:81513-81535 CCCAGGTGGACAGCCAGCTGTGG - Intergenic
985744788 5:1640319-1640341 GAAAGGGGCAGAACAAGCTGAGG - Intergenic
985788325 5:1911517-1911539 GAAAGGAGCAAAGCCAGCTGGGG - Intergenic
985822083 5:2167214-2167236 GAGTGGGGCAGAACCAGCTGGGG - Intergenic
989147801 5:38265754-38265776 GACCCGCGCAGAGCCAGCTCTGG - Intronic
993246687 5:85460228-85460250 GATTGGTGCAGAGCCAACGGAGG - Intergenic
993671281 5:90764482-90764504 GACTGTTGCAGACACAGCTGTGG - Intronic
1001218898 5:169882477-169882499 CACAGGGGCAGAGACAGCTTTGG - Intronic
1001717559 5:173829015-173829037 GACAGGTGCAGACCCTGGAGAGG - Intergenic
1002123534 5:177023592-177023614 GTCAAGTGCAGAGCAAGCTGGGG - Intronic
1002185738 5:177454121-177454143 GACAGAGGCAGAGCCAAGTGGGG + Intronic
1002307451 5:178292225-178292247 GGCAGGTGCAGGGGCAGGTGCGG - Intronic
1003381695 6:5630135-5630157 AACAGGTGAAGAGCAAGGTGAGG + Intronic
1003398820 6:5775150-5775172 GCCAGGAGCAGAGCAACCTGGGG - Intergenic
1004436435 6:15599416-15599438 TACACATGCAGAGTCAGCTGTGG - Intronic
1004477334 6:15986104-15986126 GACAGGCTCACAGCCAGCTCTGG + Intergenic
1006211281 6:32397029-32397051 GTCAGGTACAGAGGCATCTGGGG - Intronic
1006339661 6:33439918-33439940 GACTGGAATAGAGCCAGCTGGGG + Intronic
1009585795 6:65600061-65600083 GACAGGTGCAGTGGAAGCTGAGG - Intronic
1013317399 6:108955882-108955904 GACTGCTGCAGAATCAGCTGTGG + Intronic
1014787776 6:125638009-125638031 CAATGGAGCAGAGCCAGCTGAGG + Intergenic
1018434514 6:163748741-163748763 GAAAGGTTCAGACCCACCTGGGG + Intergenic
1019275979 7:175911-175933 GACTGGTGCAGAGCCTGCCATGG - Intergenic
1019601050 7:1883992-1884014 GCACAGTGCAGAGCCAGCTGGGG + Intronic
1019733816 7:2640903-2640925 TACAAGTGCGGAGCCAGCCGAGG + Intronic
1019791034 7:3014124-3014146 GACAGGAGCAGAGCCAGGCAGGG + Intronic
1021021101 7:15599730-15599752 GACAACAGCACAGCCAGCTGTGG - Intergenic
1022474658 7:30701966-30701988 CACAGGTGCTGGGCCAGCTCAGG + Intronic
1023452372 7:40301523-40301545 GAAAGGTGCAAAGCCAGGTGTGG - Intronic
1024049475 7:45609677-45609699 AACAGGTCAAGGGCCAGCTGGGG + Intronic
1024656546 7:51455572-51455594 GTAAGGGGCAGAGCCAGCCGAGG + Intergenic
1024715839 7:52078364-52078386 CACAGGTGAAGACCAAGCTGAGG - Intergenic
1026099352 7:67371895-67371917 GACAGGGGCAGACACAGCTCCGG - Intergenic
1026603112 7:71793012-71793034 GAGAGGAGCAGAGCCGGGTGCGG + Intronic
1026624292 7:71978605-71978627 GGCAGGGGCAGCGCCAGCTGTGG + Intronic
1026852735 7:73735282-73735304 GTCAGGTGGAGAGGCGGCTGAGG - Intergenic
1027264424 7:76486230-76486252 GACGGATGTAGAGCCAGATGGGG + Intronic
1027315794 7:76984344-76984366 GACGGATGTAGAGCCAGATGGGG + Intergenic
1027459924 7:78439498-78439520 GAGAGGTGCAGAGTAAGATGTGG + Intronic
1027657137 7:80944675-80944697 GACAGTCGCAGACCCACCTGGGG + Intergenic
1029888069 7:103894690-103894712 GAAAAATGCAGAGGCAGCTGTGG + Intronic
1033596897 7:142865218-142865240 GACAGGCCCAGTGCCAGATGTGG - Intronic
1034504727 7:151479239-151479261 GACAAGCCCAGAGCCACCTGAGG + Intronic
1034549156 7:151809297-151809319 GACGGGTGCAGAATCAGCAGCGG + Intronic
1035044943 7:155957610-155957632 GGCAGGTGCAGAGGGAGGTGAGG + Intergenic
1035059805 7:156060626-156060648 GACAGGTGTAGGGCAGGCTGAGG - Intergenic
1035133382 7:156676079-156676101 CACAGGTGCAGGGGCAGCTAGGG - Intronic
1035203379 7:157280133-157280155 GACAGGTGCACACCCGGCGGGGG + Intergenic
1035470741 7:159107177-159107199 CACAGGTGTAGGGCCAGGTGTGG - Intronic
1036026565 8:4915572-4915594 GGCAGGAGCAGGGACAGCTGGGG + Intronic
1037817257 8:22118789-22118811 GACAGGTGCAGAGAAGGCAGAGG - Intronic
1038311289 8:26448381-26448403 GGCTGGGGCAGAGCCAGCTAGGG + Intronic
1038473421 8:27844340-27844362 GAGAGGTGCAGCTGCAGCTGTGG + Intergenic
1039195547 8:35027339-35027361 GACAGGAGCAGAGCAGCCTGAGG + Intergenic
1041256618 8:55984327-55984349 GGCAGATGCTGAGCCAGCAGGGG - Intronic
1041781269 8:61579887-61579909 GACATTGGCAGAGCTAGCTGAGG - Intronic
1043161547 8:76853198-76853220 GGCAGCTGCAGGGCAAGCTGGGG - Exonic
1043738578 8:83777283-83777305 GACAGATGCAGATGAAGCTGTGG + Intergenic
1044234013 8:89809408-89809430 CACAGGTGCAGAGCCACCCAAGG + Intergenic
1046627795 8:116593653-116593675 GACATGTGAAGAGCCAGCCAGGG + Intergenic
1049148901 8:141021752-141021774 GATAGGTGCAGAGCCAGGTTTGG + Intergenic
1049176356 8:141194829-141194851 GACAGGGGTTGGGCCAGCTGAGG + Exonic
1049241372 8:141539064-141539086 GAAGGGCGCAGGGCCAGCTGAGG + Intergenic
1049347449 8:142146419-142146441 GTCAGGTTCAGAACCAGGTGAGG - Intergenic
1049531393 8:143157271-143157293 CCCAGGGGCAGAGACAGCTGGGG + Intergenic
1049738545 8:144222863-144222885 TACAGGTGCAGGCCCAGATGTGG + Intronic
1050371665 9:4928262-4928284 AACAGGTGCTGGGCCAGATGTGG + Intergenic
1053351889 9:37418590-37418612 GGTAGGAACAGAGCCAGCTGAGG + Intergenic
1053431835 9:38047064-38047086 TTCAGGTTCAGTGCCAGCTGTGG + Intronic
1053729646 9:41040225-41040247 GGCAGATGCAGAGCCAGTTAGGG + Intergenic
1054461520 9:65467744-65467766 AACTCATGCAGAGCCAGCTGTGG + Intergenic
1054698860 9:68391837-68391859 GGCAGATGCAGAGCCAGTTAGGG - Intronic
1054916254 9:70497749-70497771 AACAGGTGCAGACCAGGCTGCGG - Intergenic
1056964723 9:91156099-91156121 GCCAGGTGTGGAGCCATCTGAGG - Intergenic
1057274941 9:93671173-93671195 TACAGGTGTAGATGCAGCTGTGG + Intronic
1057274959 9:93671277-93671299 CACAGGTGCAGATGCAGATGTGG + Intronic
1057275176 9:93672517-93672539 TACAGGTGCAGATGCAGGTGTGG + Intronic
1057885165 9:98824279-98824301 AACAGGTGCAGAAGGAGCTGAGG - Intronic
1058327342 9:103715261-103715283 GACAGCTGGGAAGCCAGCTGTGG - Intergenic
1058886439 9:109324899-109324921 GACAGATTCAGAGCCTGGTGAGG - Intergenic
1059500217 9:114746091-114746113 CAGAGCTGCAGAGCCAGATGTGG + Intergenic
1060529478 9:124339940-124339962 GACGGGGGCAGGGGCAGCTGGGG - Intronic
1060699433 9:125737975-125737997 TACAGGTGCAGGGCTGGCTGTGG + Intergenic
1061415228 9:130443986-130444008 CCCAGGTTCAGAGCCGGCTGAGG + Intergenic
1061674524 9:132208255-132208277 GACAGGTGCAGTGCCTTCTAAGG + Intronic
1061871396 9:133522586-133522608 GACCAGTGCAGAGGCAGCTGCGG + Intronic
1062196898 9:135279438-135279460 GAGAGCTGCTGAGGCAGCTGCGG + Intergenic
1062276448 9:135733582-135733604 GGCAGGTGCAAAGGCAGGTGTGG - Intronic
1062335049 9:136061302-136061324 GCCATGGGCAGAGCCTGCTGTGG - Intronic
1062394247 9:136346340-136346362 GACAGGAGCAGAGGGAGCTGAGG - Intronic
1062395607 9:136351427-136351449 GTGATGGGCAGAGCCAGCTGTGG - Intronic
1062556560 9:137115530-137115552 AACAGGTGCAGGGGCAGCAGGGG + Intergenic
1189236919 X:39494369-39494391 GGCAGCTGCAGAGCCAGCCCCGG - Intergenic
1190110047 X:47583472-47583494 CACAGGTGCAGGCCCTGCTGGGG - Exonic
1190248393 X:48705530-48705552 GACAGGTAGGGAACCAGCTGGGG + Intronic
1193083280 X:77426202-77426224 GACAGAGGCTGAACCAGCTGGGG - Intergenic
1194114117 X:89874215-89874237 GACAGGTGCAGAGCCAAGAGAGG - Intergenic
1194366265 X:93018390-93018412 GATTGGTGCAGAGCCAGGGGAGG + Intergenic
1194595116 X:95847957-95847979 GACAGGTGCCTATCCTGCTGTGG - Intergenic
1196940675 X:120772822-120772844 TATAGGTCCAGAGCCAGCTAGGG + Intergenic
1200466858 Y:3529571-3529593 GACAGGTGCAGAGCCGAGAGAGG - Intergenic
1200674490 Y:6134652-6134674 GATTGGTGCAGAGCCAGGGGAGG + Intergenic
1200965814 Y:9036590-9036612 GACAGGAGCAGACCCAACTTGGG - Intergenic