ID: 934037450

View in Genome Browser
Species Human (GRCh38)
Location 2:88100022-88100044
Sequence TAGGAGAAGGAGCAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2030
Summary {0: 1, 1: 0, 2: 8, 3: 181, 4: 1840}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934037450 Original CRISPR TAGGAGAAGGAGCAGGAGGT GGG (reversed) Intronic
Too many off-targets to display for this crispr