ID: 934039030

View in Genome Browser
Species Human (GRCh38)
Location 2:88112365-88112387
Sequence CAGTGGTCTGAGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 508
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 459}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934039030_934039036 2 Left 934039030 2:88112365-88112387 CCTCCTTCCCTCTCAGACCACTG 0: 1
1: 0
2: 4
3: 44
4: 459
Right 934039036 2:88112390-88112412 ATGCAAGTCCTTCTTCCCTTTGG 0: 1
1: 0
2: 0
3: 17
4: 198
934039030_934039038 14 Left 934039030 2:88112365-88112387 CCTCCTTCCCTCTCAGACCACTG 0: 1
1: 0
2: 4
3: 44
4: 459
Right 934039038 2:88112402-88112424 CTTCCCTTTGGAATGTACTCTGG 0: 1
1: 0
2: 0
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934039030 Original CRISPR CAGTGGTCTGAGAGGGAAGG AGG (reversed) Exonic
900117910 1:1036342-1036364 CAGTGGTCTGAAAGATAGGGTGG + Intronic
900473473 1:2865608-2865630 CAGGGGCCTGAGAGGTGAGGTGG + Intergenic
900636103 1:3666534-3666556 AAGGGGTCTGACAGTGAAGGTGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901051837 1:6429205-6429227 CAGGGGTCTGAGCGGGGAGTGGG + Intronic
901653248 1:10755116-10755138 CAGTGGTGTGGGTGGGAACGTGG + Intronic
902169254 1:14597840-14597862 CTGTGGTCTGGGAGAGAAAGAGG + Intergenic
902264827 1:15255818-15255840 TAGAGGTCAGAGTGGGAAGGGGG + Intronic
902482496 1:16719164-16719186 CAGGGGTCTGAGCGGGGAGTGGG - Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902717298 1:18281624-18281646 GAGTGGGCTGAGGAGGAAGGAGG - Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
902927357 1:19704934-19704956 CAGTGGTCTAAGGAGGAAAGGGG - Intronic
903357793 1:22758712-22758734 CAGTGGTATGAGGGGCAAGCTGG + Intronic
903548635 1:24142632-24142654 CACTGGCCTGACAGGGGAGGAGG - Intronic
903707326 1:25295824-25295846 CAATGGTCTGGGAGGGAATATGG + Intronic
903719915 1:25397518-25397540 CAATGGTCTGGGAGGGAATATGG - Intronic
904214838 1:28911074-28911096 CAGAAGTCTGAGAGGGCAGATGG + Intronic
904302140 1:29561296-29561318 CAGGGTTCTGTGAGCGAAGGAGG + Intergenic
904401272 1:30258175-30258197 CAGGGTTCTGTGAGTGAAGGAGG - Intergenic
904862547 1:33549697-33549719 CAGTGATAAGAAAGGGAAGGAGG + Intronic
905009060 1:34734596-34734618 GAGTGGCCTGAGAGGGAGGCTGG + Intronic
906139378 1:43524678-43524700 CACTGGCCTGAGAGAGGAGGAGG + Intergenic
906305993 1:44719552-44719574 CAGTGGTCTGGGAAGGCAGAGGG - Intronic
906969390 1:50495241-50495263 CAGTGGGGTGTGGGGGAAGGTGG - Intronic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907733832 1:57092656-57092678 CAGTGGTCTGGCGGGGGAGGGGG + Intronic
908105567 1:60838356-60838378 CAGTGTTCTAAGAGGGTACGAGG - Intergenic
909426226 1:75528069-75528091 TAGTGTTCCCAGAGGGAAGGAGG - Intronic
911032168 1:93500684-93500706 TAGTGGTCCCAGAAGGAAGGGGG + Intronic
912543430 1:110433931-110433953 CTGTGGGCTGAGAGTGCAGGAGG - Intergenic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
914877927 1:151526118-151526140 CAGTGCTTTGGGAGGCAAGGTGG - Intronic
914908753 1:151768129-151768151 CAGAGGTCTGGGAGGTAAGGCGG - Exonic
914984249 1:152442550-152442572 CAGTGCACTGAGCGGGAAGAGGG - Intergenic
915148193 1:153808110-153808132 AAGTGGTGGGAGAGGGAGGGGGG - Exonic
915169712 1:153969179-153969201 CAGTGTTCTTTGTGGGAAGGGGG + Intronic
915871533 1:159564875-159564897 CTGTGGTCTCTGAAGGAAGGTGG + Intergenic
916045714 1:160998669-160998691 CAGTGGTAGGAAAGGGAGGGAGG + Exonic
916254692 1:162774796-162774818 CCCTGGTTTGAGACGGAAGGGGG + Intronic
917073273 1:171176053-171176075 AAGTGGTTGGAGTGGGAAGGTGG + Intergenic
917492933 1:175513683-175513705 CAGAGCTCTGACAGGGAAGAGGG + Intronic
918004244 1:180526769-180526791 CAGTGGTGTGGGAGAGAAGGGGG + Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918405730 1:184210095-184210117 CAATCCTCTTAGAGGGAAGGGGG - Intergenic
918451798 1:184665650-184665672 CAGAGGTCTGACAGGGGATGGGG + Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919565582 1:199181342-199181364 CAGTCTTGTGAGTGGGAAGGTGG - Intergenic
919705345 1:200670024-200670046 CAGTGGCTTGGGAGGGAGGGAGG + Intergenic
920370297 1:205474631-205474653 CAGGGGTTGGAGAGGGATGGGGG - Intergenic
921121907 1:212144598-212144620 CAGAGGCCTGAGAGGAAACGTGG + Intergenic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921349266 1:214218980-214219002 TAGTGGTCAAAGAAGGAAGGAGG - Intergenic
922061957 1:222101343-222101365 AAGTTCTCAGAGAGGGAAGGTGG - Intergenic
923374599 1:233348149-233348171 CCTAGGGCTGAGAGGGAAGGGGG - Intronic
923483867 1:234410654-234410676 CCGGGGTCTGGGTGGGAAGGGGG + Intronic
924252445 1:242146046-242146068 CAGGGGTCAGAGATGGAAAGTGG + Intronic
924293831 1:242565808-242565830 GAGGTGTCTGTGAGGGAAGGTGG - Intergenic
1062879556 10:966931-966953 CAGTGTTCTGAGAGCCAAGTGGG - Intergenic
1063337437 10:5229300-5229322 CATTGGTCTGAGGGGGGAGGTGG + Intergenic
1065584447 10:27203923-27203945 CAGTGTTCTGAAAGGCACGGTGG - Intronic
1065671293 10:28121059-28121081 CAGTGTTTTGGGAGGCAAGGTGG + Intronic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069204625 10:65666489-65666511 CCCTGGGCTTAGAGGGAAGGTGG - Intergenic
1069780062 10:70949722-70949744 CAGTGGTCTAGGAGAGAGGGAGG + Intergenic
1069987749 10:72295884-72295906 CAATGGGCTGAAAAGGAAGGAGG - Intergenic
1070525173 10:77290020-77290042 CAGGGGTTAGAGATGGAAGGAGG + Intronic
1071133595 10:82426197-82426219 CAGGGGTCTCAGAGTGAAGATGG - Intronic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1072249245 10:93568516-93568538 AAGTGGTCAGAGAGGGGAGTAGG + Intronic
1073213869 10:101826058-101826080 CAGTCTTCTGATGGGGAAGGGGG + Intronic
1073326407 10:102646108-102646130 CAGAGGCCTGAGGGGGGAGGCGG - Intronic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1076094525 10:127720493-127720515 CAGTGGACTGAGGGGGCACGTGG + Intergenic
1076628185 10:131834532-131834554 CGGTGGTCTCTGAGGCAAGGGGG - Intergenic
1077458433 11:2695013-2695035 CAGTGGTCAGAGAGGTAAGCAGG + Intronic
1078185844 11:9051499-9051521 CTGAGGTCTGAGAGGGAGTGAGG + Intronic
1078379041 11:10823054-10823076 CAGTGTTGGGAGAGGGAAAGAGG + Intronic
1078509140 11:11972848-11972870 AAGAGGCCTGGGAGGGAAGGCGG + Intronic
1079231114 11:18649559-18649581 CAGTAGTGTGAAAGGGAAGCTGG + Intergenic
1079486995 11:20945451-20945473 CAGTGCTCTGAGAGTGACAGAGG + Intronic
1079695814 11:23481487-23481509 CAGTGGTCTGTGGGGGAAACAGG + Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081590379 11:44418760-44418782 AAAAGGACTGAGAGGGAAGGAGG - Intergenic
1081779004 11:45696919-45696941 AAGTGGTGTCAGAGGGGAGGAGG - Intergenic
1083182494 11:60996269-60996291 CACTGCTCTGATAGGGAAAGGGG - Intronic
1083579771 11:63817708-63817730 CAGTGGTTTGAGTGGGATGGGGG - Intronic
1083735186 11:64676122-64676144 CAGCGGGCAGAGAGGGCAGGGGG + Intronic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1085282863 11:75342243-75342265 CAGGGCTCGGAGAGGGAAGCAGG - Intronic
1085339130 11:75719940-75719962 CAGGGGTCTGAGAGGAAGGCAGG - Intronic
1085728834 11:78979086-78979108 CAGTGGTCTGTGAGGCTGGGAGG + Intronic
1087219749 11:95533447-95533469 CATTGCTCTGGGAGGGAAAGTGG - Intergenic
1087439885 11:98170018-98170040 CAGTGGGGTGAGAGGGATGGGGG + Intergenic
1087873665 11:103329435-103329457 CAGTAGTTTGGGAGGGAAAGTGG + Intronic
1088315185 11:108499277-108499299 CAGAGGGCTGTGAGGGAGGGCGG - Intergenic
1090214694 11:124951544-124951566 AAGAGATCTGAGAGGGAGGGAGG + Intergenic
1090351259 11:126110037-126110059 CTGTGGTGTGAGAGAGGAGGAGG - Intergenic
1090610716 11:128467956-128467978 CAGCCGCCTGAGAGGGAGGGTGG - Intronic
1090663123 11:128895698-128895720 CAGTGGTCTGAGAGCTCAGAGGG - Intronic
1090722178 11:129485674-129485696 CAGCGATCTGAGGGGGAGGGAGG - Intergenic
1090837160 11:130462050-130462072 AAGAGGACTGAGAGGGCAGGAGG - Intronic
1091330377 11:134727295-134727317 CAGTGGTCAAAGAGCCAAGGGGG - Intergenic
1091357314 11:134947267-134947289 CAGTGGACAGAGTGGGAAGGTGG - Intergenic
1092264992 12:6974095-6974117 GAATGGTCTGAGAGGGAAACAGG - Intronic
1092343619 12:7697253-7697275 GAGTTGTCTGAAAAGGAAGGAGG - Intergenic
1093498347 12:19782601-19782623 CAGTGCTTTGAGAGGGCAAGAGG + Intergenic
1093507262 12:19882623-19882645 GAGTGGTCAGAGAGCCAAGGAGG - Intergenic
1094191109 12:27699554-27699576 CAATGGCCTGAGAGGGGAAGGGG - Intergenic
1096675210 12:53222447-53222469 CAGATTTCTGAGGGGGAAGGGGG - Intronic
1098878189 12:75889041-75889063 TATTTGTCAGAGAGGGAAGGAGG - Intergenic
1099505470 12:83470901-83470923 CAGATGTCTGAGTGGGCAGGAGG - Intergenic
1100956459 12:99914669-99914691 CAGGGCTCTGATAGGGAAAGGGG + Intronic
1102317859 12:111904596-111904618 CAGTGGACTGAGTGAGAGGGTGG + Intergenic
1103504458 12:121432486-121432508 CAGTGGTCTGGGAGGCTGGGTGG - Intronic
1104313808 12:127678922-127678944 CAGTTGTCTGGGAAGGAAAGAGG + Intergenic
1104832505 12:131763298-131763320 CAGGTGACTGAGAGGGAAGTGGG - Intronic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1105201374 13:18182542-18182564 CAGTGGTCTGAGATCGAACTGGG + Intergenic
1105648253 13:22344723-22344745 CTTTGGTCGGAGAAGGAAGGCGG - Intergenic
1105649994 13:22366632-22366654 CAGAGGTGGGAGAGGGTAGGGGG + Intergenic
1105726619 13:23169147-23169169 CTGTGCTCTGGGTGGGAAGGGGG - Intergenic
1105843106 13:24272513-24272535 GAGAGCTCTGAGAGGGCAGGGGG + Intronic
1106224668 13:27775870-27775892 CAGGGCTCTGACGGGGAAGGCGG - Intergenic
1107361426 13:39621758-39621780 CTGTGGTCTGAGAGGGTAGTTGG - Intergenic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1110035130 13:70673165-70673187 CAGAGCTCTCAGAGGGAGGGTGG - Intergenic
1110121633 13:71888806-71888828 CAGTTGGCAGAGAGGGAATGTGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112239429 13:97666493-97666515 CAGTAGACTGAGAGAGAAGATGG - Intergenic
1112370835 13:98792011-98792033 CAGTGTTGTGAGGGGGAAGTAGG + Intergenic
1112495970 13:99905052-99905074 CACAGGTCTCAGAGGGAAAGGGG + Intergenic
1116085299 14:40229609-40229631 AAGAGGTGTGAGAGGGAGGGAGG - Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1117438415 14:55739557-55739579 AAGTGTTCAAAGAGGGAAGGGGG + Intergenic
1118176890 14:63449528-63449550 CAATGGGCTTAGAGGGAATGAGG + Intronic
1120056642 14:79932055-79932077 TAGTGGGCTCAGAGGGCAGGGGG - Intergenic
1121105952 14:91279827-91279849 CAGGGGCCTGGGAAGGAAGGGGG + Intronic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122882025 14:104694479-104694501 AGGTGGGCTGAGTGGGAAGGCGG + Intronic
1123467330 15:20526774-20526796 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1123650784 15:22474268-22474290 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1123741192 15:23283110-23283132 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1123745805 15:23319448-23319470 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1124278077 15:28342765-28342787 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1124304626 15:28568843-28568865 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1125582114 15:40793520-40793542 CAGTGGTCAGGGTAGGAAGGCGG - Intronic
1125681228 15:41531426-41531448 CAGTGGACTGTGAGGGATAGAGG - Intronic
1125909189 15:43421032-43421054 CAGTGGTCCGAGAAGGTGGGCGG + Exonic
1127018087 15:54711288-54711310 GAGTGGTTTGAGAAGCAAGGTGG + Intergenic
1128158033 15:65404029-65404051 CCAAGGTCAGAGAGGGAAGGGGG + Intronic
1128227334 15:66011241-66011263 GAGGGGACTGAGAAGGAAGGTGG + Intronic
1128343234 15:66837174-66837196 CTGTAGTCTGAGAAGGACGGCGG - Intergenic
1128575323 15:68770356-68770378 AACTGGTCTGAGAGGGTGGGTGG + Intergenic
1128636795 15:69307726-69307748 AGGTGGACTGAGAGGGAAAGAGG + Intronic
1128986276 15:72224048-72224070 GAGTGGTCTTTGAGGGAAGTAGG - Intronic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129654599 15:77515785-77515807 CAGAGGTTTGAGAAGGAATGTGG + Intergenic
1129698717 15:77755246-77755268 CAGGGATCTGATGGGGAAGGAGG + Intronic
1129823989 15:78622256-78622278 GGGTGGTCAGAGAGGGCAGGAGG - Intergenic
1129826915 15:78640532-78640554 CACTGGGCCGAGAAGGAAGGGGG - Intronic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129892583 15:79081462-79081484 CAGGGCTCTGAGTGGGAAAGGGG - Intronic
1130168892 15:81491513-81491535 CGGTGGTATTAGAGAGAAGGTGG + Intergenic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1131283377 15:91038738-91038760 CAGTGGTCTGAGATCCAAGAAGG + Intergenic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132701217 16:1222911-1222933 CAGGGACCTGGGAGGGAAGGTGG + Exonic
1132743279 16:1426511-1426533 CAGTGGGCTGAGTGGGACGGGGG - Intergenic
1133027783 16:2996238-2996260 CAGGCTTCTTAGAGGGAAGGGGG + Intergenic
1133905538 16:10018877-10018899 CAGTGCTCAGATTGGGAAGGTGG - Intronic
1135139368 16:19908433-19908455 CAGAGGCCTGACAGGGATGGAGG + Intergenic
1135940931 16:26821158-26821180 CATTGGTCTGAGAGGGAGGTGGG + Intergenic
1136083604 16:27868864-27868886 GAGTGGCCTGGGAGGGAATGTGG - Intronic
1136089126 16:27905855-27905877 CAGGGGTGGGAGTGGGAAGGTGG - Intronic
1136655191 16:31705459-31705481 CAGTGGCCTGAGAGGTGTGGAGG + Intergenic
1137751552 16:50864575-50864597 CAATGGACTGGGAGGGAAAGAGG + Intergenic
1138533637 16:57648289-57648311 CAGTGGTCAGAGGTGGCAGGAGG + Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138786487 16:59852523-59852545 TACTGCTCTGAGAGAGAAGGTGG + Intergenic
1139467855 16:67163855-67163877 AAGCGCTCTGAGAGGGAACGGGG + Exonic
1140035862 16:71370822-71370844 CAGTGCTGTGATGGGGAAGGAGG - Intronic
1140131503 16:72165980-72166002 CAATGGTGTGAAAAGGAAGGTGG + Intronic
1140290506 16:73650440-73650462 CAGTCCCCTGAGAGTGAAGGAGG - Intergenic
1140347862 16:74232391-74232413 CAGTGCTTTGGGAGGCAAGGTGG - Intergenic
1140357399 16:74318238-74318260 CTGGGGTCTGGGAGGGGAGGTGG + Intergenic
1140357582 16:74319433-74319455 CAGCCATCTGAGTGGGAAGGAGG - Intergenic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1140910466 16:79446662-79446684 CAGTGCTTTGGGAGGCAAGGTGG + Intergenic
1141013650 16:80427058-80427080 CAGTGGTGGGAAAGGGAGGGAGG - Intergenic
1141824342 16:86468475-86468497 CACTGGCCTGGGAGAGAAGGGGG + Intergenic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1142067518 16:88071352-88071374 CAGTGGATTGAGTGGGAAGTGGG + Intronic
1142068146 16:88074417-88074439 CAGTGGGTTGGGAGGGTAGGGGG + Intronic
1142427126 16:90007184-90007206 CAGGTGTCTGGGAGGGAATGGGG - Intronic
1143201549 17:5116605-5116627 CAGGGGTCTGTCAGGAAAGGCGG + Exonic
1144359525 17:14478601-14478623 GAGTGGTCAGCCAGGGAAGGCGG - Intergenic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1145117866 17:20228299-20228321 CAGTGCTTTGAGAGGCCAGGAGG - Intronic
1146453562 17:32993025-32993047 CGGTGCTCTCGGAGGGAAGGTGG + Intronic
1146913545 17:36663674-36663696 CACTGGTCTGTTAGGGAAGACGG - Intergenic
1147178908 17:38673084-38673106 CAACGGTCCGAGATGGAAGGAGG + Exonic
1147182803 17:38697381-38697403 CAGTGGACTGTGACAGAAGGGGG - Intergenic
1147387111 17:40089190-40089212 GAGCGGTCTGTGAGGGAAGAGGG - Exonic
1148138594 17:45311967-45311989 CAGTGGGCTGACAGCGGAGGGGG - Intronic
1150047531 17:61927974-61927996 TACTGGTCTGAGAGGAAGGGTGG + Exonic
1151237129 17:72728803-72728825 GAGTGAACTGAGAGGGAAGAAGG - Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1152730704 17:81968227-81968249 CTGCTGTCTGGGAGGGAAGGTGG + Intergenic
1152763439 17:82121933-82121955 GGGTGGCCTGGGAGGGAAGGCGG - Intronic
1152784096 17:82239114-82239136 CAGTGTTTTGAGGGGGAAGGTGG + Exonic
1153538828 18:6133543-6133565 TAGTGCTCTGTGAGGGGAGGAGG - Intronic
1153599114 18:6761636-6761658 CAGTGGTCAGTGAGGGAATTGGG + Intronic
1153943484 18:9997095-9997117 CAGTTTCCTGAGAGGGAAGCTGG - Intergenic
1154047508 18:10920803-10920825 CAGCAGTCTGGGAGGCAAGGTGG + Intronic
1154134170 18:11761349-11761371 CTGTGCTCTGAGAGGGCATGGGG - Intronic
1157108234 18:44794733-44794755 CAGTGGTATGTGAAGGTAGGAGG - Intronic
1157750055 18:50170191-50170213 CAGTGGGCAGTGAGGAAAGGAGG + Intronic
1158438906 18:57455979-57456001 CAGAGCTCTGAGAGGGAACCGGG - Intronic
1159306677 18:66652363-66652385 CAGTGCTGTGAGAGGGAAATGGG - Intergenic
1161269556 19:3382352-3382374 TGGTGGTCTGAGAGGGGAAGTGG + Intronic
1161452859 19:4356202-4356224 CAAGGCTCTGAGAGGGGAGGGGG - Intronic
1161647054 19:5459685-5459707 CATAGGGGTGAGAGGGAAGGAGG + Intergenic
1161659795 19:5539219-5539241 CGGTGGGCTCACAGGGAAGGTGG + Intergenic
1161844778 19:6706603-6706625 CCGCTGTCTGAGAGGGTAGGAGG - Intronic
1162057072 19:8071260-8071282 GGGTGGCCCGAGAGGGAAGGAGG + Intronic
1162536321 19:11264632-11264654 CAGCAGCCTGAGAGGCAAGGCGG - Intergenic
1162612145 19:11765075-11765097 CTGTGGTCTGAGAGTGCAGTTGG + Intergenic
1163012415 19:14433966-14433988 CAGTGCCCTGGGAGGGGAGGAGG + Intronic
1163558971 19:18007983-18008005 CCGGGGTCCGCGAGGGAAGGGGG + Intronic
1164104576 19:22096719-22096741 CAAGGGTCTGAGAGGGAAATAGG - Intergenic
1164678760 19:30120196-30120218 GAGTGGGCTGAGAGGTAAGGAGG + Intergenic
1164729297 19:30490437-30490459 CAGGGGTCTGAGGAGGAAAGGGG + Intronic
1164752293 19:30665857-30665879 CAGAGGACTGAGAGGAAAGGAGG + Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165404924 19:35623736-35623758 CAGTTGCCTCTGAGGGAAGGTGG + Exonic
1166260936 19:41640447-41640469 CAGGGCTCTGAGAGGGATCGAGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166688445 19:44809439-44809461 CAGGGTGCTGAGTGGGAAGGGGG - Intronic
1166718699 19:44985423-44985445 CAGTGCTCAGGGAGGGGAGGTGG - Intronic
1167445905 19:49537374-49537396 CAGGGGACTGAGAGTGGAGGTGG - Intronic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1168201513 19:54818820-54818842 CAGGGGACTGAAGGGGAAGGTGG + Intronic
1168206252 19:54852503-54852525 CAGGGGACTGAAGGGGAAGGTGG + Intronic
925395403 2:3529890-3529912 CAGTGGACTGACAGGGCTGGAGG - Intergenic
926259274 2:11242397-11242419 CAGAGCTCAGAAAGGGAAGGAGG + Intronic
927650441 2:24909944-24909966 TGGTGGTCTCAGAGAGAAGGTGG - Intronic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
928659795 2:33490609-33490631 TAGAGGTCAGAGAGGGGAGGAGG - Intronic
930048186 2:47192463-47192485 AAGGGGTCTGGGAGGGCAGGGGG - Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932730668 2:74219830-74219852 AAGTGGGATGAGAAGGAAGGTGG + Intronic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
934554130 2:95278490-95278512 CAATGGTGGGAGAGGGATGGGGG + Intronic
935901639 2:107799171-107799193 GAGTGGGCTGCCAGGGAAGGAGG + Intergenic
936539857 2:113341292-113341314 CAGTGGGCTGAGGGGAGAGGGGG - Intergenic
936622123 2:114111155-114111177 CAGAGATCTGAGAGTGAAAGGGG + Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
938220310 2:129560657-129560679 CAGGGGACAGAGAGAGAAGGAGG - Intergenic
938805216 2:134800850-134800872 CATTGGTCTGAGATGGGAAGAGG + Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939629175 2:144513971-144513993 GAGTGGGGTGAGGGGGAAGGAGG - Intronic
940111864 2:150163538-150163560 GAGTTGCCTGAGAGGGATGGAGG + Intergenic
940956223 2:159731139-159731161 CAGCACTCTGGGAGGGAAGGTGG - Intronic
941635645 2:167932393-167932415 CAGTGGACTGGAAGGGAAAGAGG - Intergenic
941692708 2:168517778-168517800 CAGGGGTCTGAGAGTGTAAGAGG + Intronic
942828064 2:180204423-180204445 AACTGGTTTGAGAGGGAAGGCGG + Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
944098452 2:195995630-195995652 CAGTGGTGTGGGGGTGAAGGCGG + Intronic
944260130 2:197667948-197667970 CAGTGGGCTGGGTGGGTAGGAGG + Intronic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
944661017 2:201921580-201921602 CACTGAACTGAGAGGGAAGTGGG - Intergenic
945139330 2:206667209-206667231 ATGAGGTCAGAGAGGGAAGGGGG - Intronic
945432892 2:209785479-209785501 CTCGGGGCTGAGAGGGAAGGAGG + Intronic
948431786 2:237923379-237923401 CAGGGGGCTGGGAGGAAAGGAGG - Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
1169189385 20:3648186-3648208 CCTTGGTCTGAGAGGGAGGGTGG - Exonic
1170684699 20:18559053-18559075 CACTACTCTGACAGGGAAGGTGG + Intronic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1172900383 20:38330446-38330468 CAGTGATCTCAGAGGAAGGGGGG - Intronic
1173470818 20:43322019-43322041 CAGTGCCCTGAGAGGGAGGGTGG + Intergenic
1173497209 20:43528418-43528440 CAGTGGCCTGAGCGGGTGGGGGG + Intronic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1173880170 20:46406232-46406254 CAGCGGTCGGAGGGAGAAGGAGG - Intronic
1174068728 20:47885131-47885153 AGGTGGTTTGAGAGGGAATGTGG + Intergenic
1175196003 20:57243786-57243808 AAAGGGGCTGAGAGGGAAGGAGG - Intronic
1175817822 20:61892847-61892869 GGCTGGTCTTAGAGGGAAGGAGG + Intronic
1176051957 20:63124656-63124678 CAGTGGCCTGAGCCGGGAGGGGG - Intergenic
1176164309 20:63664750-63664772 GAGGGGTCTGAGAGGAAGGGAGG + Intronic
1176659543 21:9621590-9621612 CAATGGTGTGAGAGAGAAGAGGG + Intergenic
1178460631 21:32799102-32799124 GAGTGGACTGAGAGGGTAGAAGG + Intronic
1179049799 21:37879439-37879461 CAGTGGGCAGAGTGGTAAGGGGG + Intronic
1179571731 21:42282547-42282569 CAGTGGTCCCAGATGGAAGGAGG - Intronic
1179955803 21:44737534-44737556 CAGTGGTGTGTAAGGGAAGAGGG - Intergenic
1179965613 21:44802928-44802950 GAGTGGAGTGAGAGGGAGGGAGG - Intergenic
1180032264 21:45220575-45220597 CACTTGTCTGACAGGGCAGGTGG - Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180800698 22:18630589-18630611 CAGGGGTCTGTGTGGGGAGGGGG - Intergenic
1180851930 22:19026146-19026168 CAGGGGTCTGTGTGGGGAGGGGG - Intergenic
1181043833 22:20205347-20205369 CAGGCGTGTGAGAGGGAAGTGGG - Intergenic
1181221021 22:21364673-21364695 CAGGGGTCTGTGTGGGGAGGGGG + Intergenic
1181783417 22:25208848-25208870 CAGTGGTCAGTGGGGGGAGGTGG - Intergenic
1181996083 22:26883842-26883864 CAGGGGCCAGAGAGGGGAGGCGG - Intergenic
1182016664 22:27046084-27046106 GAGTGGCCTCAGAAGGAAGGAGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182626508 22:31650756-31650778 CAGTGATCTCACAGGGATGGAGG + Intronic
1183390051 22:37540614-37540636 CAGTGGGCTGAGGGAGATGGAGG - Intergenic
1184164056 22:42717079-42717101 CACTGGTCTGGAAGGGAAGGGGG + Intronic
1184242574 22:43218939-43218961 CAGAGGTCAGAGAGAGGAGGAGG - Intronic
1184760087 22:46538731-46538753 CAGTGGTCGGGGACGGTAGGTGG + Intergenic
949539298 3:5019939-5019961 CTGTGGCCAGAGAGGAAAGGGGG - Intergenic
950266246 3:11575213-11575235 CTGTGGTGCGAGAGGGAAGGCGG + Intronic
950654341 3:14427467-14427489 CAGAGGCCTGGGAAGGAAGGCGG - Intronic
950698930 3:14726744-14726766 CACTGGGCTGAGAGGGAGAGAGG + Intronic
951016598 3:17739263-17739285 CAGTGGTCTGAGACAAAAAGGGG + Intronic
953694197 3:45145502-45145524 CAGTGGACTTTGAGGGCAGGAGG - Intronic
953957219 3:47240700-47240722 TAGAGGTCTGAGATGGGAGGGGG - Intronic
954195430 3:48994053-48994075 CAGATGTGTGAGAGGGAAGAGGG + Intronic
954718217 3:52537722-52537744 CAGTGCTGTGAGAAGGAAGTGGG + Intronic
955343925 3:58147051-58147073 CAGGGGTCTGATAAGGAGGGTGG - Intronic
956320969 3:67995839-67995861 CAGTGGGCTGAGCAGGGAGGAGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
958464127 3:94437743-94437765 CATTTTTCTGAGAGGGTAGGAGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959575478 3:107928335-107928357 CCGTGCTTTGAGACGGAAGGAGG - Intergenic
959926025 3:111922876-111922898 GAGTGGTCTTTGATGGAAGGAGG - Intronic
961496641 3:127297724-127297746 CAGTGGTGTGAGAGGTGTGGGGG + Intergenic
961706041 3:128786022-128786044 CAGTAGTCTGACAAGGAAGAAGG - Intronic
961862973 3:129932482-129932504 GTGTGGTCTGAGAGGTAAGAAGG - Intergenic
962006355 3:131353794-131353816 CAGTGGGCTCAGAGTAAAGGAGG + Intergenic
962192110 3:133321821-133321843 CTGTGGTCTGAGAGGGCACTTGG - Intronic
962930566 3:140032073-140032095 CTTTGGTCTGTGGGGGAAGGAGG - Intronic
965024165 3:163277415-163277437 CAGTGGTCAGAAAGGTAACGGGG - Intergenic
965642316 3:170842936-170842958 CCATTGTCTGAGAGAGAAGGAGG - Intronic
966653623 3:182328176-182328198 CACTGGTCTTAAAGGGAAGATGG + Intergenic
966819044 3:183910692-183910714 CGCTGGTCTGAGAGAGAAGAGGG + Intergenic
967248398 3:187512522-187512544 CAGAGGGCAGAGAGGGAAAGAGG + Intergenic
967367370 3:188702415-188702437 CAGTGTTCTGAGACGGAAGAAGG - Intronic
967997340 3:195176815-195176837 CTGTGCTCTGTGAGGTAAGGAGG - Intronic
969573592 4:8024159-8024181 CCCTGGCCTGAGAAGGAAGGAGG - Intronic
969629933 4:8330117-8330139 CAGGGGACTGAGAGGGAAGTGGG + Intergenic
971490419 4:27206335-27206357 CAGTGCTCTGTGGGGGAAGGGGG - Intergenic
971810268 4:31416332-31416354 CAGTGGGCTGAGATGGAGGGTGG + Intergenic
971947109 4:33294995-33295017 CAGTGAGCTGAGAGGGAGGGAGG - Intergenic
973646045 4:52952279-52952301 CAGAGGTGTGAGAGGGGATGGGG - Intronic
975642686 4:76516081-76516103 CAGTAGACCGAGAGGGAAAGTGG + Intronic
976352888 4:84080711-84080733 CAGTGGTGTGAGTGGGAGGTAGG - Intergenic
978795329 4:112702915-112702937 CCAGGGTCTGAGAGAGAAGGAGG + Intergenic
979217142 4:118179500-118179522 AAGTGGTAAGGGAGGGAAGGTGG + Intronic
979973711 4:127169521-127169543 TAGTGGTTGGAGAGGGAAAGAGG - Intergenic
981602527 4:146506641-146506663 GAGTGGCCTGAGAGGTAAGAAGG - Intronic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983795866 4:171861989-171862011 CAATGGTCTTATATGGAAGGTGG + Intronic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
985275191 4:188231298-188231320 CAGAGATCTGAGCAGGAAGGAGG - Intergenic
985294282 4:188418057-188418079 CAGTGATCTGAGTGGCCAGGTGG + Intergenic
985415828 4:189734823-189734845 CAATGGTGTGAGAGAGAAGAGGG - Intergenic
986618301 5:9643053-9643075 CTGGGGTATGGGAGGGAAGGAGG - Intronic
986903969 5:12470625-12470647 CTGTGGTCTGAGAGAGCAGTTGG - Intergenic
987742901 5:21933367-21933389 CAGTGTTCTAAGAGGGAACAGGG + Intronic
988410756 5:30882886-30882908 CAGTGATATGAAAAGGAAGGAGG - Intergenic
990182912 5:53182590-53182612 CTGTGGGCTGAGAGGAGAGGAGG + Intergenic
990500397 5:56390458-56390480 CAGAGAACTGAGAGGGAATGTGG + Intergenic
990522787 5:56595775-56595797 CAGTGGTTGAAGAGTGAAGGAGG - Intronic
990625450 5:57605336-57605358 CAGGGGTCTGAGGGAGAAAGGGG + Intergenic
990807658 5:59684171-59684193 CAGTGCTCAGGGAGGGATGGAGG - Intronic
993320499 5:86463567-86463589 CAGGGGCCTGTGAGAGAAGGGGG - Intergenic
993438750 5:87928713-87928735 CTGTGGTCTGAGAGTGTAGTTGG - Intergenic
993953037 5:94199473-94199495 AAGTGCTCTGATGGGGAAGGGGG + Intronic
998267023 5:140673855-140673877 CATTGGTCTGCTGGGGAAGGCGG + Exonic
998595195 5:143521998-143522020 CAGTGGTCTGAGGAAGAAAGAGG - Intergenic
999197445 5:149792075-149792097 GAGTGGCCTGGGAGGGAAGGTGG + Intronic
999300894 5:150489741-150489763 CAGCGGACTGACAGGGAAGGAGG + Intronic
1000525772 5:162355786-162355808 CAGAGGCCTGGAAGGGAAGGGGG - Intergenic
1001129567 5:169052779-169052801 CAGTGGTCTGAGAGGTAGCTTGG - Intronic
1001930098 5:175666676-175666698 CAGTGCTTTGGGAGGCAAGGCGG - Intronic
1003237067 6:4304311-4304333 CTGTGGTCTGAGAGGTCAGAAGG + Intergenic
1003561664 6:7185622-7185644 AAGAGGAGTGAGAGGGAAGGTGG + Intronic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1003978529 6:11367196-11367218 CAGTGGTCTGAAAGTGCAGTGGG + Intronic
1004006107 6:11638513-11638535 CAGAGGTGTGTGAGGCAAGGAGG - Intergenic
1004342425 6:14819163-14819185 AGGTTGTCTGAGAAGGAAGGAGG - Intergenic
1005282755 6:24291914-24291936 CAATGGGGTGAGAGGGCAGGAGG + Intronic
1005436964 6:25822961-25822983 CAGTGGTGGGGGAGGGCAGGAGG - Intronic
1006275864 6:33005244-33005266 CAGTACTTTGGGAGGGAAGGTGG + Exonic
1006361242 6:33588595-33588617 CACTGTGCTGAGGGGGAAGGAGG + Intergenic
1007231381 6:40349619-40349641 CAGTGGTGTGAGTGGGTGGGTGG + Intergenic
1007747206 6:44050581-44050603 GAGTGGTTTGTGAGGCAAGGAGG + Intergenic
1007823538 6:44580046-44580068 TGCTGGTCTGAGAGGGAAAGGGG + Intergenic
1008966908 6:57322043-57322065 CAGTGGTTGGAGAAGGAAGGTGG + Intronic
1010180065 6:73076102-73076124 CAGTGCTTTGAGAGAGAGGGGGG - Intronic
1011534328 6:88359613-88359635 AAGTGCTCTGAGAGTGAGGGTGG + Intergenic
1012930681 6:105313172-105313194 CATTGGTCTGTGAAGGAGGGAGG - Intronic
1012995998 6:105975476-105975498 CAATGGGCTGAGAGGGAGGCAGG + Intergenic
1013482806 6:110566661-110566683 CAGTGCCCTGAGATGGAAGCAGG - Intergenic
1013603893 6:111730563-111730585 AATTGGTGGGAGAGGGAAGGGGG + Intronic
1015633741 6:135255765-135255787 CAGTGGGCTGAGAGTAAAGAAGG - Intergenic
1016237855 6:141889818-141889840 CTGTGGTCTGAGAGTGTAGTTGG - Intergenic
1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG + Intronic
1017719034 6:157232307-157232329 CAGTGGCCTGAGTGGAAAGACGG + Intergenic
1018789968 6:167140741-167140763 CAGTTCTCTGACAGGGAAGTGGG + Intergenic
1018998751 6:168729708-168729730 CAGTGGCCTCTGAGGGCAGGAGG + Intergenic
1019798714 7:3072000-3072022 CAGTGGGTTGGGAGGGTAGGTGG + Intergenic
1022090002 7:27102004-27102026 GAGTGGGCTGGGAGAGAAGGAGG - Intronic
1023130457 7:36997740-36997762 CAGTGGTAGGAGAGGAAAAGAGG + Intronic
1023592587 7:41795398-41795420 TAGTTGTCTGCGAGGGAGGGGGG - Intergenic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1023828963 7:44028329-44028351 CTGGGGTCAGAGGGGGAAGGAGG + Intergenic
1024002774 7:45201990-45202012 GAGTTGTCTGAGAGGTAAGATGG + Intergenic
1024138780 7:46440138-46440160 CAGTGGTCCCAGAGAGAAAGTGG + Intergenic
1024403760 7:48953791-48953813 CAGTGCTCTGAGAGTGGCGGTGG - Intergenic
1028567213 7:92246236-92246258 CAGCGGCCGGAGAGGGATGGGGG + Exonic
1029739262 7:102482586-102482608 CTGGGGTCAGAGGGGGAAGGAGG + Intronic
1029757263 7:102581765-102581787 CTGGGGTCAGAGGGGGAAGGAGG + Exonic
1029775203 7:102680826-102680848 CTGGGGTCAGAGGGGGAAGGAGG + Intergenic
1029910511 7:104141347-104141369 CAGTGGTGAGAGTGGGAATGAGG - Intronic
1031659021 7:124397430-124397452 CAGTGGTCTGAGCGGTCAGAAGG + Intergenic
1032854924 7:135826039-135826061 CAGTGGTATGGGAGGGAGAGAGG - Intergenic
1033599057 7:142876145-142876167 CTGGGGGCTGAAAGGGAAGGTGG + Intronic
1034087320 7:148331889-148331911 AAGTTGTGTGAGAGGGCAGGAGG + Intronic
1034088125 7:148338910-148338932 CTGTGCTCTGAGAGTGAAGGAGG + Intronic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1035851815 8:2927463-2927485 CAGTCGCCTGAGGAGGAAGGAGG + Intergenic
1036588430 8:10146583-10146605 CAGTGTTCTGAAATGGAATGTGG + Intronic
1036740058 8:11352843-11352865 CCGTGGACTGGGAGGAAAGGGGG - Intergenic
1036824989 8:11968957-11968979 CAGTGCTCTGAGAGAGACTGAGG + Intergenic
1037110449 8:15159079-15159101 CAGCCTTCTGAGAGGGGAGGGGG + Intronic
1037905445 8:22713597-22713619 CAGGGGCCTGAGAGGGAGGCCGG + Intronic
1037906518 8:22718821-22718843 AAGAGGCCTGAGAGGAAAGGGGG - Intronic
1038326144 8:26574188-26574210 CAGTTGTTTCAGAGGGAAGGAGG + Intronic
1038657669 8:29468959-29468981 GAGTGGTCAGATTGGGAAGGAGG - Intergenic
1039130062 8:34253551-34253573 CATTGCTCTGAGTGGTAAGGGGG - Intergenic
1040355736 8:46616999-46617021 CAGAGGAGTGAGAGGAAAGGAGG + Intergenic
1040694237 8:49977093-49977115 AACCAGTCTGAGAGGGAAGGTGG + Intronic
1040778281 8:51073724-51073746 CAGTTATCTGAGAGGGAAGCTGG + Intergenic
1040817764 8:51526979-51527001 CAGATGGCTGAGTGGGAAGGAGG - Intronic
1041135478 8:54753574-54753596 AACTGGTATGAGAGGGAATGTGG + Intergenic
1041537161 8:58939468-58939490 GAGTGGTCTGGGAGGGAAGGAGG + Exonic
1041698675 8:60763894-60763916 CTGTGGTCAGAGAGGAAAAGAGG + Intronic
1042156851 8:65853476-65853498 CAGTCCTTTGAGAGGTAAGGAGG - Intergenic
1044145352 8:88706606-88706628 CACTGGTATGAGAGGCAAAGAGG - Intergenic
1044427256 8:92066318-92066340 CAGTGGTCTGAAATTGAAAGTGG - Intronic
1044624523 8:94223772-94223794 CAGTGGCCTGGGAGTGAGGGGGG + Intergenic
1045593402 8:103625102-103625124 CAGTGTTTTTAGGGGGAAGGAGG + Intronic
1047520323 8:125591058-125591080 CAGAGCTCTGAGGGGGAAGCTGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048007477 8:130431177-130431199 CAGGAGTCTGGGAGGGAAGATGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048972863 8:139655005-139655027 CAGTGGACAGAGATGGATGGCGG + Intronic
1049129673 8:140827258-140827280 CAGAGGTCAGACAGGAAAGGGGG - Intronic
1049387848 8:142353356-142353378 CAATGGTCTCGGCGGGAAGGAGG + Intronic
1049405495 8:142450268-142450290 CAGGGGGCTGAGGGGGTAGGGGG - Intronic
1049417243 8:142500653-142500675 CTGAGGTCAGAGAGGGAGGGTGG + Intronic
1049636222 8:143690995-143691017 CACAGGTCTGGGTGGGAAGGGGG - Intronic
1052265542 9:26567795-26567817 CTGGGGCCTGAGAGGGAGGGAGG - Intergenic
1052857754 9:33417632-33417654 CAGAGGTGAGAGAGGGCAGGAGG - Intergenic
1052982176 9:34457842-34457864 CAGGGGTCTGGGATGGGAGGTGG - Intronic
1052990164 9:34514373-34514395 CACTGGTCGGGGAGGGAACGGGG - Exonic
1053001070 9:34577707-34577729 CAGGCCTCTGAGAGGGGAGGGGG - Intronic
1053551063 9:39079876-39079898 CGGTGGTGTGGGAGGGAGGGTGG - Intronic
1053815173 9:41899957-41899979 CGGTGGTGTGGGAGGGAGGGTGG - Intronic
1054615423 9:67287484-67287506 CGGTGGTGTGGGAGGGAGGGTGG + Intergenic
1055449503 9:76418132-76418154 AAGTGGGCAGAGAGGGGAGGAGG + Intergenic
1056443090 9:86639829-86639851 CAGTGCTCTTAGAGAGAAGTAGG - Intergenic
1057164003 9:92912469-92912491 CAGTGGGATGAGGGGCAAGGAGG + Intergenic
1057948703 9:99352528-99352550 CAGTGGTCTGAGAGTCAGGAGGG + Intergenic
1058916435 9:109570780-109570802 CTGTGGTCTGAGAGTGTAGTTGG - Intergenic
1058947167 9:109868476-109868498 CAGAGGACTGGGTGGGAAGGTGG + Intronic
1059206479 9:112471737-112471759 CAGTGGTTTGAGAGGCTGGGAGG + Exonic
1059254587 9:112918039-112918061 CAGAGGTATGACAGGAAAGGAGG + Intergenic
1059456361 9:114402610-114402632 CAGTGGGCTGGGATGGAGGGGGG + Exonic
1060102777 9:120855518-120855540 CAGTGGTAGGAGTGGCAAGGTGG + Intergenic
1060466700 9:123913063-123913085 CACTGCTCTGGAAGGGAAGGAGG - Intronic
1060740041 9:126091989-126092011 CAGTAGTCTCAAAGGCAAGGAGG + Intergenic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1061179173 9:129013883-129013905 CAGTGAGCTGGGAGTGAAGGGGG + Intronic
1062179915 9:135185776-135185798 CAGTGGCCTTAGGGGGAAGCCGG - Intergenic
1062277762 9:135738820-135738842 CAGGGGAGTGAGAAGGAAGGAGG - Intronic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062407717 9:136404832-136404854 GGGTGGTCTGAGAGTGGAGGCGG - Intronic
1062548916 9:137077212-137077234 CAGGGGACGGAGAGGGACGGGGG + Intergenic
1062694241 9:137865015-137865037 CTGTGGCCTGTGAGGGAAGCGGG + Intronic
1203637104 Un_KI270750v1:123433-123455 CAATGGTGTGAGAGAGAAGAGGG + Intergenic
1185595713 X:1305548-1305570 CAGTGACCTGGGATGGAAGGTGG + Intronic
1186250450 X:7660331-7660353 CAGTGGTGGGAGAGGGAGGGTGG + Intergenic
1187331065 X:18340164-18340186 CAGCACTCTGAGAGGCAAGGTGG + Intronic
1188767525 X:34114177-34114199 CCTTGGTCTAAAAGGGAAGGGGG + Intergenic
1189874872 X:45425591-45425613 CAGTAGTCTGGAAAGGAAGGAGG + Intergenic
1190384124 X:49868143-49868165 CACTGGTCTGACAGGAAAAGGGG + Intergenic
1191032948 X:55994767-55994789 CTGTGGTCTGAGAGTGTAGTTGG + Intergenic
1192194571 X:69019613-69019635 CAGTGGCCTCAGAGGAAAAGTGG + Intergenic
1192358057 X:70422064-70422086 CAGGGGTCTGGGTGGGATGGGGG - Intergenic
1195500417 X:105591767-105591789 CTGTGGTCTGAGATTGTAGGTGG + Intronic
1195519409 X:105813614-105813636 CAGTGGGGTGAGATGGGAGGAGG + Intergenic
1195586378 X:106569595-106569617 CTGTGGTCTGAGAGTGTAGTTGG - Intergenic
1196309651 X:114148609-114148631 CAGTGGGCTGTGAGGGATGAAGG + Intergenic
1196584334 X:117411809-117411831 CTGTGGTCTGAGAGAGTAGTTGG - Intergenic
1199599489 X:149533485-149533507 GAGTGGTCTGAGAAAGCAGGTGG + Exonic
1199651142 X:149946722-149946744 GAGTGGTCTGAGAAAGCAGGTGG - Intergenic
1199707576 X:150444037-150444059 CACTGCTCTGGCAGGGAAGGCGG + Intronic