ID: 934043707

View in Genome Browser
Species Human (GRCh38)
Location 2:88152648-88152670
Sequence CTGATAACACAGAAATTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934043705_934043707 14 Left 934043705 2:88152611-88152633 CCAAATGAAACCAGAAACAAAAA No data
Right 934043707 2:88152648-88152670 CTGATAACACAGAAATTAAAAGG No data
934043706_934043707 4 Left 934043706 2:88152621-88152643 CCAGAAACAAAAAAGAAGACATT No data
Right 934043707 2:88152648-88152670 CTGATAACACAGAAATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934043707 Original CRISPR CTGATAACACAGAAATTAAA AGG Intergenic
No off target data available for this crispr