ID: 934044359

View in Genome Browser
Species Human (GRCh38)
Location 2:88160157-88160179
Sequence CCTTCTTTCCTACATGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934044359_934044367 22 Left 934044359 2:88160157-88160179 CCAGTACCATGTAGGAAAGAAGG No data
Right 934044367 2:88160202-88160224 ACTTTCTGCCTGGTGCAGGTGGG No data
934044359_934044366 21 Left 934044359 2:88160157-88160179 CCAGTACCATGTAGGAAAGAAGG No data
Right 934044366 2:88160201-88160223 AACTTTCTGCCTGGTGCAGGTGG No data
934044359_934044363 12 Left 934044359 2:88160157-88160179 CCAGTACCATGTAGGAAAGAAGG No data
Right 934044363 2:88160192-88160214 GCATCAGCCAACTTTCTGCCTGG No data
934044359_934044364 18 Left 934044359 2:88160157-88160179 CCAGTACCATGTAGGAAAGAAGG No data
Right 934044364 2:88160198-88160220 GCCAACTTTCTGCCTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934044359 Original CRISPR CCTTCTTTCCTACATGGTAC TGG (reversed) Intergenic
No off target data available for this crispr