ID: 934045608

View in Genome Browser
Species Human (GRCh38)
Location 2:88170575-88170597
Sequence GAACCAAAGGTTCCAGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 187}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934045608_934045619 10 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045619 2:88170608-88170630 ACTTGAGGAACTTGGGAGGGTGG 0: 1
1: 0
2: 1
3: 26
4: 354
934045608_934045620 15 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045620 2:88170613-88170635 AGGAACTTGGGAGGGTGGTGCGG 0: 1
1: 0
2: 4
3: 122
4: 2291
934045608_934045617 6 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045617 2:88170604-88170626 TCGGACTTGAGGAACTTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 118
934045608_934045613 -5 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045613 2:88170593-88170615 GGTTCCGGCGCTCGGACTTGAGG 0: 1
1: 0
2: 0
3: 0
4: 29
934045608_934045623 18 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045623 2:88170616-88170638 AACTTGGGAGGGTGGTGCGGGGG 0: 1
1: 0
2: 1
3: 31
4: 488
934045608_934045621 16 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045621 2:88170614-88170636 GGAACTTGGGAGGGTGGTGCGGG 0: 1
1: 0
2: 3
3: 144
4: 4718
934045608_934045622 17 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045622 2:88170615-88170637 GAACTTGGGAGGGTGGTGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 227
934045608_934045624 19 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045624 2:88170617-88170639 ACTTGGGAGGGTGGTGCGGGGGG 0: 1
1: 0
2: 66
3: 1772
4: 21611
934045608_934045616 3 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045616 2:88170601-88170623 CGCTCGGACTTGAGGAACTTGGG 0: 1
1: 0
2: 0
3: 0
4: 34
934045608_934045615 2 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045615 2:88170600-88170622 GCGCTCGGACTTGAGGAACTTGG 0: 1
1: 0
2: 0
3: 0
4: 41
934045608_934045618 7 Left 934045608 2:88170575-88170597 CCCGTTTCTGGAACCTTTGGTTC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 934045618 2:88170605-88170627 CGGACTTGAGGAACTTGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934045608 Original CRISPR GAACCAAAGGTTCCAGAAAC GGG (reversed) Intronic
900628836 1:3623208-3623230 GAACCAGAGATTCCAGAGAGAGG - Intergenic
902983560 1:20142086-20142108 AAGCCAACGGTTTCAGAAACTGG - Intronic
903021693 1:20399652-20399674 GAAACAAAGGCCCCAGAAAGGGG + Intergenic
903908270 1:26702179-26702201 GAAGCAAATGTTCCTGAGACTGG + Intronic
903913256 1:26744355-26744377 AAACAAAAGGTTCCAGCAAGAGG - Intronic
903940698 1:26929006-26929028 GAACCAAAGGCTCCATCAGCAGG + Intronic
904904192 1:33882560-33882582 GAACCAAATTTTAGAGAAACAGG - Intronic
911181338 1:94863190-94863212 GATGCAGAGGTTCCAGAAGCTGG - Intronic
913281134 1:117186116-117186138 GAACCATCTTTTCCAGAAACTGG + Intronic
916696326 1:167240802-167240824 AAAGCAAAGGTTTCAGAAGCTGG - Intronic
917094794 1:171389383-171389405 GAAGCAAAGATTTCAGAGACAGG - Intergenic
917755068 1:178090781-178090803 AATCCAAACGTTCCAGATACTGG - Intergenic
920749128 1:208657621-208657643 GAAGCAAAGGTTACTAAAACAGG - Intergenic
921454806 1:215357829-215357851 GAATCAAAGATTCCAAAAACAGG - Intergenic
922203734 1:223429013-223429035 GAACCATAGCTTCCAGGAGCTGG + Intergenic
923151121 1:231234269-231234291 GAGGCTAAGGTTCCTGAAACAGG + Intronic
1063455594 10:6180262-6180284 GAACCTCAGGTTCCAGAGTCAGG + Intronic
1064633594 10:17341828-17341850 GAAGCAGAGGTTGCAGTAACTGG + Intronic
1065177981 10:23096818-23096840 GAACCACAGGTGATAGAAACAGG + Intronic
1066454256 10:35559639-35559661 GCACCAAAGGGCCCAGAGACAGG + Intronic
1068779974 10:60908996-60909018 GAACCAAATGTTACAGACAAGGG + Intronic
1069159283 10:65072294-65072316 GAAGAAAAACTTCCAGAAACTGG - Intergenic
1069687321 10:70326557-70326579 GAACCCAAGGTTCCATCAACAGG + Intronic
1073206477 10:101772066-101772088 GAACCCAAAGTGGCAGAAACAGG - Intronic
1075106686 10:119543715-119543737 AAACCAAATGTTCAAGAAAATGG - Intergenic
1075190127 10:120299627-120299649 TAACCAAAGGACCCAGCAACAGG - Intergenic
1076594057 10:131614084-131614106 GAAACAACTGTTCCAGACACCGG - Intergenic
1077114933 11:879872-879894 CACCCAAAGGTCCCAGAACCAGG + Intronic
1080236157 11:30070761-30070783 GAACCAAAGGGTACAGAGAAAGG - Intergenic
1081134624 11:39424284-39424306 GAAGCAAAGGTAACAGACACAGG + Intergenic
1089960953 11:122616935-122616957 GAACCAAGGGGGACAGAAACAGG - Intergenic
1091521682 12:1251323-1251345 GAAGGAAAAGTTCTAGAAACAGG - Intronic
1097278900 12:57832287-57832309 GAACCAAAATTTCCAGGGACAGG + Intronic
1097600133 12:61681306-61681328 GAGCCAACGGTTTCATAAACGGG + Intergenic
1104216320 12:126737135-126737157 GAACCACAGATACCAGATACGGG + Intergenic
1108894134 13:55301767-55301789 GAAGCCATGGATCCAGAAACAGG + Intergenic
1111964829 13:94850438-94850460 GAACAAATTGTTCTAGAAACTGG + Intergenic
1113082611 13:106534728-106534750 GGAACCGAGGTTCCAGAAACAGG + Intronic
1114204348 14:20554665-20554687 AACCCAAAGGTTCGAGAATCTGG + Intergenic
1114464290 14:22910080-22910102 GAGGCAAAGGTTGCAGTAACTGG + Intronic
1114926142 14:27402278-27402300 GAACATAATGTTGCAGAAACAGG - Intergenic
1115313326 14:32001854-32001876 AAACCAAACGTTCCTGGAACTGG + Intergenic
1116211300 14:41948734-41948756 GAATAAAATGTTACAGAAACAGG - Intergenic
1116863921 14:50016179-50016201 GAAACAAAGGGTCCAGAGATGGG + Intergenic
1117238051 14:53798951-53798973 GAGACAAAGCTTCCAGAGACAGG + Intergenic
1118869528 14:69729558-69729580 GAAACAAAGAATTCAGAAACAGG - Intronic
1119590280 14:75880752-75880774 GAACCAAAGCTTCCAGCAGGAGG - Intronic
1122551636 14:102553199-102553221 GAAACAAAGGCTCCACGAACAGG + Intergenic
1126283822 15:46987858-46987880 GACACAATGGTTCCATAAACTGG + Intergenic
1127971123 15:63962699-63962721 GAAACAAAGCTTCCAGAAGAGGG - Intronic
1129910474 15:79222133-79222155 GAACCAAAGGCTCCCGAACTTGG - Intergenic
1130236407 15:82138725-82138747 AAACCAAAGCTTTCAGCAACAGG + Exonic
1130543245 15:84836970-84836992 GAAGCAAAGGTTTCAGGAAGTGG + Intronic
1130866688 15:87939567-87939589 GACCCAAAAGTTGAAGAAACAGG + Intronic
1131235369 15:90692247-90692269 GAAACAAAGGTCACAGAAAGTGG + Intergenic
1131744803 15:95435790-95435812 GAAACAGAGGTTCCAGAACCTGG - Intergenic
1132007578 15:98243179-98243201 GAAGAAAAAGTTCCAGAGACGGG + Intergenic
1132021693 15:98368132-98368154 CAACCCAAGGTTCTAGAAACTGG - Intergenic
1134195235 16:12154645-12154667 AAACAAAAAGTACCAGAAACTGG + Intronic
1135588220 16:23687510-23687532 GAACCAGTGGTTCGAGAGACAGG + Exonic
1137764152 16:50964673-50964695 GAGCCACAGCTTCCAGGAACAGG - Intergenic
1140135625 16:72203138-72203160 AAACCAAAGATTCCAGAACTGGG - Intergenic
1142752083 17:1995003-1995025 GAACCACATGCTCCAGACACAGG - Intronic
1146972455 17:37083798-37083820 GAGCCAGATGTTCCAGAAAGGGG - Intergenic
1152969068 18:143726-143748 GAACCAAAGGTATCTGAGACAGG - Intergenic
1155542382 18:26881947-26881969 GAACCTAAGGTTGCAGACAGAGG - Intergenic
1156494063 18:37514313-37514335 GAACCAAAGCTTCCTGCAAAAGG + Intronic
1156809451 18:41228993-41229015 GAAGCAGTGGTTCCTGAAACTGG - Intergenic
1157825302 18:50806820-50806842 GAAACTGAGGTTCCAGAAGCGGG - Exonic
1158121871 18:54057440-54057462 TAACCACAGGTCCCAGAATCAGG - Intergenic
1158367516 18:56755170-56755192 GAATAAAATGTTCCAGAAATAGG - Intronic
1159159260 18:64622332-64622354 GAAGCATAGGCTCCAGAAACTGG - Intergenic
1159206522 18:65260378-65260400 GACCCAGAGGTTTCAGAAAGAGG - Intergenic
1160427106 18:78786044-78786066 GAAGCAAAGATTTCAGAAATCGG + Intergenic
1162668632 19:12236880-12236902 CAACCAAAGGTTAAAAAAACAGG - Intronic
1165154140 19:33777291-33777313 GAACCACGGGATCCAGAAATGGG + Intergenic
1165675556 19:37719554-37719576 GAACCAAAAGGTCCCGGAACCGG + Exonic
1167462584 19:49633766-49633788 GAAACAGAGGTTGCAGCAACTGG + Intergenic
1168065257 19:53915543-53915565 GAACCACAGGTCCCTGGAACTGG - Intronic
928681157 2:33703425-33703447 GAACCATAAGAACCAGAAACTGG - Intergenic
929202112 2:39246452-39246474 GAATCAACAGTTTCAGAAACTGG - Intergenic
929253502 2:39783495-39783517 GAAGCTAAGCTTTCAGAAACTGG - Intergenic
930429610 2:51257518-51257540 GAACGAAAGGTAACAGAGACTGG + Intergenic
931090059 2:58876223-58876245 GAAACAAAGTTGCCAGAACCTGG - Intergenic
932658479 2:73630978-73631000 GAAACAGAGGTTACAGTAACTGG + Intergenic
933993007 2:87647125-87647147 CAACCAGAGCTTCCAGAAACTGG - Intergenic
934045608 2:88170575-88170597 GAACCAAAGGTTCCAGAAACGGG - Intronic
936300850 2:111303754-111303776 CAACCAGAGCTTCCAGAAACTGG + Intergenic
936676656 2:114723469-114723491 GAGCCAAAGATTCCAAGAACTGG - Intronic
937152724 2:119696919-119696941 GAACAAAAGCTTCCAGACACAGG - Intergenic
938840228 2:135154258-135154280 CAACCAAAGTTTCCAACAACAGG + Intronic
939496805 2:142935166-142935188 GAACCAAAGGTTTAAGATAGTGG + Intronic
946609537 2:221442439-221442461 GAACCAAAGATTCCAGCACAAGG + Intronic
946723984 2:222642876-222642898 GAACCAATCCTTCCAGACACAGG + Exonic
1169293691 20:4374573-4374595 GCAGCAGAGGTTCCAGAAATGGG + Intergenic
1169703113 20:8471212-8471234 GAACCATAGGCTCAATAAACGGG + Intronic
1173012738 20:39196949-39196971 GAATCAAAGGCTCAAGAAAAAGG - Intergenic
1175994874 20:62807541-62807563 GAATGACAGGGTCCAGAAACTGG + Exonic
1178799717 21:35781188-35781210 GACCCAAAGGTGCAAAAAACAGG + Intronic
1178918286 21:36721886-36721908 GACTCAAAGGCTACAGAAACAGG - Intronic
1179768539 21:43594958-43594980 AAACAAAAGTTTCCAGAAAGGGG + Intronic
1182622453 22:31625568-31625590 GAACCAAAGATACCTGAAGCGGG + Intronic
1182810385 22:33111229-33111251 GAAACCAAGGTTCCAGAAATGGG - Intergenic
1183437217 22:37803033-37803055 GGCGCAAAGGATCCAGAAACCGG + Intergenic
1184187294 22:42873323-42873345 CAACCAAAGATATCAGAAACTGG + Intronic
951046948 3:18050455-18050477 GAACCAAAGGTTCTAAAAATAGG + Intronic
951681580 3:25300570-25300592 GAACCAAAGCTTTCTGTAACAGG + Intronic
953820367 3:46202999-46203021 AAACCAAATATTCCAGAGACTGG - Exonic
954573298 3:51660079-51660101 AAACCAAAGGTTCCTGAAGATGG + Exonic
954829785 3:53410661-53410683 CAACCGAAGTTTCCAGCAACAGG - Intergenic
954893976 3:53959769-53959791 GAACCAAAGATTCAGGAAAAAGG - Intergenic
954932362 3:54295328-54295350 AAACCAAAGGTATCTGAAACAGG + Intronic
956500980 3:69884936-69884958 GTTCCAATGTTTCCAGAAACTGG - Intronic
956881203 3:73512371-73512393 GAACCAAGGGTTTATGAAACTGG - Intronic
957302076 3:78405194-78405216 TAACTAAATGTTCCACAAACTGG - Intergenic
958183635 3:90090400-90090422 GAACCAATTGTTCCAGCAAGAGG + Intergenic
960215338 3:115027860-115027882 TTAAGAAAGGTTCCAGAAACAGG + Intronic
960266779 3:115629090-115629112 GAATCAAAGGATTTAGAAACTGG - Intronic
961146681 3:124599621-124599643 GTCCCAAATGTTACAGAAACAGG - Intronic
962555497 3:136546888-136546910 GAAGCACAGGTTGAAGAAACAGG - Intronic
962634700 3:137318947-137318969 GAAACAAAGCTTCCAGACAAAGG - Intergenic
965453711 3:168871113-168871135 TGATCAGAGGTTCCAGAAACAGG - Intergenic
965774794 3:172217203-172217225 CAACCAAGGGTTCTAAAAACTGG + Intronic
968442030 4:629023-629045 GAACCACAGGTCCCAGAAGGCGG + Intronic
969068757 4:4513409-4513431 TAACCAAAGGATAGAGAAACAGG + Intronic
971520439 4:27543142-27543164 GAAACAAAGATTACAGAAAATGG + Intergenic
971711662 4:30120538-30120560 GAACCACTGATTCCACAAACAGG - Intergenic
973946737 4:55964544-55964566 GAACCATAGTATCCAGAAATAGG + Intronic
975340937 4:73239385-73239407 CAACCAAAATTTCCATAAACTGG + Intronic
975654506 4:76628298-76628320 GAACCAAGGATTTCAGAAACAGG - Intronic
975890007 4:79016506-79016528 TAACCAAGTCTTCCAGAAACTGG - Intergenic
978128315 4:105161595-105161617 GAAACAAAGGTCCGAGAAAGAGG - Intronic
978273659 4:106922095-106922117 GAACCAAAGTTTGTATAAACAGG - Exonic
978817271 4:112922119-112922141 AAACCAAAGGTTCTAGAAACTGG - Intronic
980203364 4:129685202-129685224 TACCCTAAGTTTCCAGAAACAGG + Intergenic
981115795 4:140989607-140989629 GAAACTAAGCTTCCAGAAAGAGG + Intronic
983302085 4:165938737-165938759 GAACAGAAAGTTCCAGAAAGTGG - Intronic
983748013 4:171225506-171225528 GAACCAAGGGTTGCAAAGACAGG - Intergenic
983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG + Intergenic
986344490 5:6822262-6822284 GAACCCATGGTTTCTGAAACAGG + Intergenic
987622137 5:20347889-20347911 GAAAGCAAGTTTCCAGAAACAGG - Intronic
989283532 5:39672490-39672512 AAACCAAAGTTTCCAAAAGCTGG - Intergenic
989307295 5:39973093-39973115 GAACATAATGTTCCAGGAACAGG + Intergenic
990184977 5:53202474-53202496 GAACCAAAGGTTTAAGATAGTGG - Intergenic
991711145 5:69409770-69409792 GAAGCAAAAGTTTCGGAAACTGG - Intronic
992498602 5:77318828-77318850 AAACCAAATATTCCAAAAACTGG + Intronic
996079129 5:119235646-119235668 AAACCAAAAGTTACACAAACAGG - Intronic
996742663 5:126815498-126815520 CAACCAAAGTCTCCAGAATCTGG - Intronic
998963407 5:147511696-147511718 GGAACAAAGGCTCCGGAAACTGG + Intergenic
999335767 5:150715089-150715111 GAACCAAACCTTCCAGTAACTGG - Intronic
999811481 5:155131509-155131531 GAACCCCAGGCTCCAGAAGCAGG - Intergenic
1000682488 5:164203134-164203156 GAACCAAAGATGCCTGAAAAAGG + Intergenic
1002394860 5:178944721-178944743 GAACCAAAGGTCCAAGAGAAAGG - Intronic
1002553249 5:180014025-180014047 AAATCAAACGTTCCAGAGACAGG + Intronic
1003078370 6:3001544-3001566 TAACCTAAGGTCCCAGAAATAGG + Intronic
1003332398 6:5140599-5140621 CAACTCCAGGTTCCAGAAACGGG - Intronic
1008037649 6:46762759-46762781 GATCTAAAGGTTCCAGACTCTGG - Intergenic
1010555065 6:77268708-77268730 AAACCAAAGGCTCCGGAACCTGG - Intergenic
1013063019 6:106655858-106655880 GACCCAAAAGTGCCATAAACAGG - Intronic
1013740541 6:113278775-113278797 GAAACAATGGTTCCAAAACCTGG - Intergenic
1017200652 6:151750862-151750884 AAACAAAAGCTTACAGAAACAGG - Intronic
1017562618 6:155645647-155645669 GAAACAAAGGTTTCAAATACAGG + Intergenic
1019385288 7:752090-752112 GAACGAGAGCGTCCAGAAACAGG + Intronic
1019907030 7:4072648-4072670 GCACCAACACTTCCAGAAACCGG - Intronic
1023572886 7:41590890-41590912 GAACCAAATGTTTTAGAACCAGG + Intergenic
1025565058 7:62424171-62424193 GCAAAAAAGGTTCCAGAAATGGG + Intergenic
1026209109 7:68287562-68287584 CATCCAGAGGTTCCAGAAACTGG + Intergenic
1026990754 7:74584015-74584037 AAACCAAAAGTGCCTGAAACAGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1032132348 7:129240566-129240588 GAACAAGCAGTTCCAGAAACAGG - Intronic
1034968497 7:155405522-155405544 GAAAAAAAGATTTCAGAAACTGG - Intergenic
1036146119 8:6256405-6256427 GAACCAAAAGTACCTGAGACAGG + Intergenic
1037982171 8:23262059-23262081 GAACCAAAGTGTGCAGAAGCTGG - Intergenic
1040457136 8:47610145-47610167 GAACAAAAGTTTCCAGAGAAAGG - Intronic
1042699419 8:71595808-71595830 GAAAAACAGGTTCCAGAAAAAGG + Intergenic
1043485531 8:80695411-80695433 TAACCAAAGGTTTAAGAACCAGG + Intronic
1044079745 8:87868909-87868931 AAAACAATGGTTCCACAAACTGG - Intergenic
1045595474 8:103650290-103650312 GAAAAAAAGCTTCCAGAAAAAGG - Intronic
1046178201 8:110606943-110606965 TAGCCAAAGGTTCAAGAAAAGGG - Intergenic
1046191885 8:110806685-110806707 GAACCAACACTTACAGAAACTGG + Intergenic
1046591573 8:116213570-116213592 GAAACTAAGGAACCAGAAACTGG - Intergenic
1046994012 8:120495348-120495370 GAGACAAAGTTTCCAGAAAGTGG - Intronic
1048091473 8:131245383-131245405 AGACCATAGCTTCCAGAAACCGG - Intergenic
1049814314 8:144591079-144591101 GAAGCAAAGGTGACAGAGACCGG - Intronic
1050891800 9:10833952-10833974 TTACCAGAGGTTCCAGAGACAGG - Intergenic
1052084017 9:24241565-24241587 GAAAAAAAGGTTCCAGACATGGG + Intergenic
1052287084 9:26798470-26798492 AAACAAAATGCTCCAGAAACAGG + Intergenic
1054944392 9:70780329-70780351 GAAGTAAAGGTTTCATAAACAGG + Intronic
1057963266 9:99477791-99477813 GGACCAAAGGTTTCAGAACATGG + Intergenic
1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG + Intergenic
1186019121 X:5234719-5234741 GATCCAAAGGCACCAGAATCTGG - Intergenic
1186124797 X:6401541-6401563 TAAGCAAGGGTTCCAGAAAAAGG - Intergenic
1186626315 X:11297380-11297402 GAAACCAGGGTTCCAGAAAGAGG - Intronic
1187742215 X:22368297-22368319 GACCCAAAGGCCCCAGAACCAGG - Intergenic
1187874697 X:23794544-23794566 GTACCAAAGGTTTTAGCAACTGG + Intergenic
1188326179 X:28804602-28804624 GAAGTAAAGGTTACAGAGACTGG - Intronic
1189005734 X:36992549-36992571 AAATCACATGTTCCAGAAACAGG - Intergenic
1190410500 X:50132585-50132607 GAACCAAGGGTTCCCAAAATAGG + Intergenic
1191121595 X:56912180-56912202 GAAACAAAGCTTCCAGAGAAAGG - Intergenic
1192210641 X:69125643-69125665 GAAGCCAAGGTTCAGGAAACAGG + Intergenic
1194584326 X:95714587-95714609 GAACCTAATGTCGCAGAAACAGG - Intergenic
1194953031 X:100149622-100149644 TAATCAAAGGTTACAGAAAGAGG - Intergenic
1201672312 Y:16537573-16537595 GAACTCAAGGATCCAGCAACTGG - Intergenic