ID: 934046042

View in Genome Browser
Species Human (GRCh38)
Location 2:88173180-88173202
Sequence CCCCCTCAAAGTTGACCCGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 37}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934046042_934046051 8 Left 934046042 2:88173180-88173202 CCCACGGGTCAACTTTGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 934046051 2:88173211-88173233 TCTGGCTATGCACCTGACGGGGG 0: 1
1: 0
2: 0
3: 0
4: 71
934046042_934046045 -10 Left 934046042 2:88173180-88173202 CCCACGGGTCAACTTTGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 934046045 2:88173193-88173215 TTTGAGGGGGCCCTCTTCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 120
934046042_934046049 6 Left 934046042 2:88173180-88173202 CCCACGGGTCAACTTTGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 934046049 2:88173209-88173231 TCTCTGGCTATGCACCTGACGGG 0: 1
1: 0
2: 0
3: 5
4: 119
934046042_934046048 5 Left 934046042 2:88173180-88173202 CCCACGGGTCAACTTTGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 934046048 2:88173208-88173230 TTCTCTGGCTATGCACCTGACGG 0: 1
1: 0
2: 0
3: 9
4: 129
934046042_934046050 7 Left 934046042 2:88173180-88173202 CCCACGGGTCAACTTTGAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 934046050 2:88173210-88173232 CTCTGGCTATGCACCTGACGGGG 0: 1
1: 0
2: 0
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934046042 Original CRISPR CCCCCTCAAAGTTGACCCGT GGG (reversed) Exonic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
911817587 1:102373143-102373165 CCCCTTCTAAGTTGACTCATAGG + Intergenic
912681664 1:111733011-111733033 GCCCCTCAGAGTTTAGCCGTGGG - Intronic
912697213 1:111850419-111850441 ACCCCTCACAGCTGACCCATAGG + Intronic
914381981 1:147124644-147124666 CCCCCTCAATGGTGACCCTCAGG - Intergenic
921683833 1:218067085-218067107 CCCCTTCAAAGTTGTCACCTTGG - Intergenic
1077281735 11:1749114-1749136 CCCCCTCAAGGTTGGGCCGCTGG - Intronic
1078453498 11:11457543-11457565 CCCCCTCAAGGTTGGGCCGCAGG + Intronic
1096110508 12:49026488-49026510 CCCGCTCAATGTAGACCCGCCGG + Exonic
1100401415 12:94233308-94233330 GCCCCTCAAAGTCCACCCTTTGG - Intronic
1101672076 12:106884844-106884866 CCTCCTCACAGTTGTCCCTTAGG - Intronic
1103732156 12:123034809-123034831 CCTGCTCAAAGTTGCACCGTTGG - Intronic
1107788811 13:43980292-43980314 CCACCTCAAAGTTGACTGGCAGG + Intergenic
1124700408 15:31907496-31907518 TCCCCTCAAAGTTGACTTGTTGG - Intergenic
1128427983 15:67562129-67562151 CCCCTTCCAAGTTGTCCCCTTGG + Intronic
1138176977 16:54909407-54909429 CCCCCTCAAAGCTCACACCTGGG - Intergenic
1143912059 17:10258800-10258822 CACCCTCAAGGTTGAACCGTTGG + Intergenic
1150808876 17:68340632-68340654 GCCCCTCGAAGTTGACTCTTGGG + Intronic
1151942274 17:77300359-77300381 CACCCTCAAGGCTGACACGTGGG - Intronic
1162592210 19:11599280-11599302 CCCTCTCAAAGCTCACCCCTGGG + Intronic
925279634 2:2674118-2674140 CCTCCTCAAATTTCACCAGTTGG + Intergenic
934046042 2:88173180-88173202 CCCCCTCAAAGTTGACCCGTGGG - Exonic
936709149 2:115111361-115111383 CCCCCACCAAGTTGATCCTTAGG - Intronic
948150037 2:235737893-235737915 CCTCATCAAAGTTGAACCTTAGG + Intronic
948355551 2:237374478-237374500 CCCTCTCAGAGATGACCTGTTGG + Exonic
1171020123 20:21577223-21577245 CAGCCTCAAAGTTGACCCCAAGG + Intergenic
1172726716 20:37049292-37049314 CACCCTCAAGGTTGAACCCTCGG + Intronic
1180099247 21:45576751-45576773 CACCCTCAAAATCGACCTGTAGG - Intergenic
1184388111 22:44187744-44187766 CCCCCCAAAAGTTGTCCCCTTGG + Intronic
970854738 4:20638566-20638588 CCCCCTCAAAGTTTATATGTTGG + Intergenic
984287063 4:177744393-177744415 CCCCCTCCATCTTGACCCATAGG + Intronic
1000030294 5:157395907-157395929 ACCCCTCAAAGTGCACCAGTGGG - Intronic
1001796337 5:174505307-174505329 CCCCATCAGAGTTGGCCCTTGGG + Intergenic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1035193364 7:157192406-157192428 CACCCTCAAGGTTGAACCCTTGG + Intronic
1044601666 8:94011560-94011582 CCCCCTCAAAGCTCACCCCTGGG + Intergenic
1046200299 8:110918699-110918721 CCCATACAAAGTTGACCCTTTGG - Intergenic
1051114583 9:13679849-13679871 CCCCCTCAAAGTTATCCAGGAGG + Intergenic
1058600199 9:106660585-106660607 CCCCCTCAAAATTCACATGTTGG - Intergenic
1060103175 9:120857514-120857536 CCCCTTCACACGTGACCCGTGGG - Exonic
1060567396 9:124605259-124605281 CCCCCTCTAAGTTGAGACGTTGG - Intronic
1062040302 9:134401501-134401523 CACCCTCAAGGTGGCCCCGTGGG - Intronic