ID: 934046303

View in Genome Browser
Species Human (GRCh38)
Location 2:88175392-88175414
Sequence GTGTTTGGAGGTGTGTGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 799
Summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 730}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934046300_934046303 11 Left 934046300 2:88175358-88175380 CCAGATGACAACGGTGCTGAAGC 0: 1
1: 0
2: 1
3: 7
4: 68
Right 934046303 2:88175392-88175414 GTGTTTGGAGGTGTGTGCTGAGG 0: 1
1: 0
2: 2
3: 66
4: 730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934046303 Original CRISPR GTGTTTGGAGGTGTGTGCTG AGG Exonic
900137385 1:1123691-1123713 GTGTGTGTAGGTGTGTGCACAGG - Intergenic
900137400 1:1123781-1123803 GTGTGTGCAGATGTGTGCTCAGG - Intergenic
900137401 1:1123803-1123825 GTGTGCGCAGGTGTGTGCTCAGG - Intergenic
900137403 1:1123827-1123849 GTGTTTGCAGATACGTGCTGAGG - Intergenic
900137404 1:1123861-1123883 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137409 1:1123918-1123940 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900137411 1:1123940-1123962 GTGTGTGCAGGTGTGTGCGCAGG - Intergenic
900137428 1:1124138-1124160 GTGTGTGCAGGTGTGTGCTCAGG - Intergenic
900137437 1:1124188-1124210 GTGTGTGCAGGTGTGTGCCCAGG - Intergenic
900159337 1:1216130-1216152 GAGGTGGGAGGTGTGAGCTGAGG - Intergenic
900405555 1:2491471-2491493 GTGTGCGGAGGTGTGTACAGAGG - Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
900575098 1:3379113-3379135 GTGTTGGGAGGGGTGAGTTGGGG - Intronic
901278492 1:8012279-8012301 TTGTTTGGGGATGTGTGTTGTGG - Exonic
901351256 1:8598904-8598926 GTGTTTTGAAGTCAGTGCTGTGG - Intronic
901780336 1:11590111-11590133 GTGTGTGGAGGTGAGTGCTGAGG - Intergenic
901892152 1:12275899-12275921 GTGTTAGGAGGTGTGGCCAGGGG - Exonic
902445887 1:16463981-16464003 GTATTTGGAGGTGAGTTCTTTGG - Intergenic
902718484 1:18289046-18289068 GTGTGTGGATGTGTGGGGTGTGG + Intronic
902806036 1:18861909-18861931 GTGTTTGGAGGTGTGGGTTCTGG + Intronic
902806354 1:18863559-18863581 GTGTTGGGACGTGTGGGCTCTGG + Intronic
903693979 1:25194214-25194236 GAGCATGGAGGTGTGTGCCGTGG - Intergenic
903779542 1:25812422-25812444 GTGTTTGTATGTGTGTGAAGTGG - Intronic
904054516 1:27661341-27661363 GTGTTTGGAGCTGGGCTCTGAGG + Intergenic
904113848 1:28147565-28147587 GTGTTTGTCTGTGTGTGTTGCGG - Exonic
904470390 1:30732260-30732282 GTGTGTGGAGGGGTGTGGGGAGG + Intergenic
904936323 1:34132190-34132212 GTCCATGGAGGGGTGTGCTGGGG - Intronic
905145959 1:35886954-35886976 GTGTTTGGATGTGTGTGATGGGG + Intronic
905167600 1:36092103-36092125 GGGGCTGGAGGTGTGTGGTGTGG + Intronic
905273092 1:36799871-36799893 GTGTTTGTATGTGTGAGCTTCGG - Exonic
905410410 1:37764647-37764669 GTGATTGGAGGTGGGAGGTGCGG - Intronic
905676408 1:39828461-39828483 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
905763290 1:40578967-40578989 CTGTTTGGGGGTGGGGGCTGGGG + Intergenic
905856424 1:41317580-41317602 GTGTTTGGAGTTCTGAGCTAAGG - Intergenic
905897654 1:41559000-41559022 GTCAAGGGAGGTGTGTGCTGGGG - Intronic
906802168 1:48747688-48747710 GTCTTTGTAAGTGTTTGCTGGGG + Intronic
907275537 1:53314793-53314815 GTGAATGGATGTGTGAGCTGTGG - Intronic
907311043 1:53539213-53539235 GTGTGTGTTGGTGTGTGTTGGGG - Intronic
907411613 1:54287423-54287445 GGGGTGGGAGGTGTGTGCTGAGG + Intronic
910159176 1:84255248-84255270 GTATTTGGAGGTGGGTCCTTTGG + Intergenic
910700687 1:90071087-90071109 GTTTATGGAGGTCTGTGCTGGGG - Intergenic
910838539 1:91539471-91539493 GTATTTGCAGGTGTGGGCTCTGG + Intergenic
912555882 1:110515788-110515810 GTGTTGGGAGTTGTGTGAGGTGG + Intergenic
912693452 1:111821825-111821847 CTGTTTGGAAGTGGGTGGTGGGG + Intronic
913967680 1:143390810-143390832 GTATTTGGAGGTGTGGTCTTTGG + Intergenic
913976078 1:143456800-143456822 GTGTTTGGAGGTGTGGGAATAGG - Intergenic
914070475 1:144282420-144282442 GTGTTTGGAGGTGTGGGAATAGG - Intergenic
914108680 1:144683934-144683956 GTGTTTGGAGGTGTGGGAATAGG + Intergenic
915044922 1:153004248-153004270 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
915094825 1:153454898-153454920 CTGTTTGGAGCTCTGGGCTGTGG + Intergenic
915161108 1:153921792-153921814 GTGTTTGGAAGTTGATGCTGGGG + Intronic
915680017 1:157572341-157572363 GTGTTTGGAGCTGTATGGTCAGG + Intergenic
915965831 1:160307414-160307436 GTGTTTGGAGGGGACTGGTGGGG - Intronic
916531732 1:165663064-165663086 GTGTGTGGAGATGGGTGATGTGG - Exonic
918058823 1:181045187-181045209 GTTTTTGGAGGTGGGTTTTGAGG + Intronic
918101317 1:181377441-181377463 GTGTTTAGAGATGAATGCTGGGG + Intergenic
918391659 1:184070242-184070264 GTGTTTGTATGTGTGTGTTGGGG - Intronic
918492956 1:185102248-185102270 GTGTGTGGATGTGTGTTTTGGGG + Exonic
918694843 1:187532767-187532789 GTGTTTGGAGGTATGAGCACTGG - Intergenic
919193531 1:194253920-194253942 GTGTGTGTATGTGTGTGGTGAGG - Intergenic
919575804 1:199308060-199308082 GAGTGAGGAGTTGTGTGCTGCGG - Intergenic
919928295 1:202204474-202204496 GTGTGTGGAGGTGTGTTTGGAGG - Intronic
920655609 1:207872417-207872439 GTGTGTGGATGTGTTTGTTGAGG + Intergenic
920982594 1:210852291-210852313 GTGTTTGGAGCTGGGAGCTTGGG + Intronic
921015198 1:211183314-211183336 GTGTTTGGAGTTCTGAGCTAAGG - Intergenic
921118093 1:212113467-212113489 TTATCTGGAGGTCTGTGCTGGGG + Intergenic
921334011 1:214068068-214068090 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
921567819 1:216741431-216741453 GTATTTTGGGGTGTGTGCAGGGG - Intronic
922188737 1:223298429-223298451 GTGTTTGGAGCTGTGGATTGGGG - Intronic
922189064 1:223301257-223301279 GTGCTGGGAGGTGTGGGCTTTGG - Intronic
922888003 1:229035290-229035312 GTGATGGGAGGGGTGTACTGTGG + Intergenic
923010678 1:230085250-230085272 GTGTTTGGAGTTTTGAGCTAAGG + Intronic
923301935 1:232649394-232649416 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
923377949 1:233384711-233384733 GTGTTTGCATGTGTGTGTTGGGG + Exonic
923540098 1:234882617-234882639 GTTTGAGGAGGTCTGTGCTGAGG - Intergenic
923541823 1:234893720-234893742 GTGGTTAGGGGTGTGTGTTGGGG - Intergenic
923622001 1:235587272-235587294 GTGTGTGAAGGTGTGGGTTGGGG + Intronic
1062799803 10:370482-370504 GTAGTCAGAGGTGTGTGCTGTGG - Intronic
1062853915 10:769758-769780 GTGTTTGAAGGTGGGTCCTTTGG + Intergenic
1063186285 10:3654644-3654666 ATGTTTGGCGGTGTGAGCAGAGG + Intergenic
1063662868 10:8045932-8045954 CTGTTTAAAGGTGTGTGTTGAGG + Intergenic
1064174044 10:13058788-13058810 TTGTTTGGAGGTGGATGATGAGG + Intronic
1064563210 10:16613093-16613115 GTGTTTGCAAGTGAGAGCTGGGG - Intronic
1064858733 10:19801272-19801294 GGGTGTAGTGGTGTGTGCTGTGG + Intergenic
1065856019 10:29830948-29830970 GAGTTTGGTTGTTTGTGCTGGGG - Intergenic
1065871355 10:29959034-29959056 GTATTTGGAGGTGGGACCTGGGG + Intergenic
1066746278 10:38605614-38605636 GAGTCTGGTGGTGTCTGCTGCGG + Intergenic
1067001694 10:42620540-42620562 GGGTGTGGTGGTGTGCGCTGTGG - Intronic
1067180339 10:43980636-43980658 CAGTGTGGAGGTGTCTGCTGAGG - Intergenic
1067229782 10:44398025-44398047 GTGTCTGGAGCTGCCTGCTGTGG - Intergenic
1067295629 10:44973792-44973814 GTGTGTGTTGGTGTATGCTGCGG + Intronic
1067414480 10:46093019-46093041 GTGTGTGGGTGTGTGTGCTTCGG - Intergenic
1067419700 10:46134847-46134869 GTTCCTGGAGGTGTGGGCTGGGG - Intergenic
1067426318 10:46214564-46214586 GTTCCTGGAGGTGTGGGCTGGGG + Intergenic
1067434545 10:46267561-46267583 GTGTGTGGGTGTGTGTGCTTCGG - Intergenic
1067839384 10:49663986-49664008 GTTTCTGGTGCTGTGTGCTGAGG - Intronic
1068220429 10:54038315-54038337 GTGTTTGCAGGTGGGTTCTCTGG + Intronic
1068401355 10:56531766-56531788 GTGTTTGGGGGCCTGTCCTGGGG + Intergenic
1068430602 10:56927188-56927210 GTGTGTGAAGCTGTGTGTTGTGG - Intergenic
1068442363 10:57074695-57074717 GTCTTTAGAGGTGATTGCTGAGG + Intergenic
1068788259 10:61001082-61001104 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1069819441 10:71218274-71218296 GTGTTTGGGTGTGTGTGGGGTGG + Intronic
1070647486 10:78211810-78211832 GTGTGTGTACGTGTGTGATGAGG + Intergenic
1070784520 10:79155279-79155301 TTGCTTGGAGGTGTTGGCTGGGG + Intronic
1070811551 10:79300640-79300662 GTGTTTAGAGGTGTGTGACCTGG + Intronic
1070975154 10:80600537-80600559 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1071158222 10:82715998-82716020 GTATTTGGAGGTGTGGCCTTTGG - Intronic
1071793357 10:88979846-88979868 GTGTGAGGAGGTGTGTGGTGAGG - Intronic
1072107625 10:92289910-92289932 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1072662486 10:97371257-97371279 GGGGTTGGGGGTGTGTGCCGTGG + Intronic
1072798728 10:98376837-98376859 GTGTGTGTTTGTGTGTGCTGTGG + Intergenic
1073201077 10:101736361-101736383 GGGTGTGGTTGTGTGTGCTGTGG + Intergenic
1073337139 10:102718285-102718307 CTGTGTGTATGTGTGTGCTGAGG + Intronic
1074107129 10:110396809-110396831 ATCTTTAGAGGTGTCTGCTGAGG + Intergenic
1075316520 10:121457852-121457874 GTGTGTGCAGGTATATGCTGAGG - Intergenic
1075747589 10:124738459-124738481 GAGTTTGTAGGAGCGTGCTGGGG - Intronic
1076021060 10:127073882-127073904 TTCTTTGGAGCTGTCTGCTGAGG + Intronic
1076042450 10:127262278-127262300 GTGTGTGTACCTGTGTGCTGAGG + Intronic
1076081031 10:127580758-127580780 GTGTTTGGGTGTGTTTGCTTTGG - Intergenic
1076549996 10:131272178-131272200 GTGTGTGGAGCTGTGTGTGGAGG - Intronic
1076557357 10:131335924-131335946 GTATTTGGAGATGGGGGCTGTGG + Intergenic
1076594996 10:131619785-131619807 GTGTTCTAAGGTGTGTCCTGTGG + Intergenic
1076756225 10:132573537-132573559 ATGTTGGGTTGTGTGTGCTGTGG + Intronic
1076759752 10:132597097-132597119 GTGTTTGCATGTGTGTGCATGGG + Intronic
1077024267 11:432334-432356 GTGGTTGCAGGTGCGGGCTGTGG - Intronic
1077529236 11:3087517-3087539 GTGGGTGCAGGTGTGTGCAGGGG - Exonic
1077745403 11:4898409-4898431 CTGTTTGGGGTTGTTTGCTGTGG + Intronic
1078063174 11:8061349-8061371 GTGTGTGGGGGCGTGTGCTGTGG + Intronic
1078607014 11:12785689-12785711 GTCTTTGGAGGTTTGGTCTGTGG + Intronic
1078856231 11:15208262-15208284 GTGTTTGGGGGTGTGAGGAGTGG - Intronic
1079902735 11:26208164-26208186 GTGTCTGGAGGTGGGGGCTTTGG - Intergenic
1080830931 11:35892710-35892732 GTATTTGGAGGTGGGTCCTTTGG + Intergenic
1080884201 11:36350335-36350357 GTGTATGCATGTGTGTGCCGGGG + Intronic
1080937580 11:36880601-36880623 GTGTTTGGAGTTCTGAGCTAAGG + Intergenic
1081611017 11:44563501-44563523 GTGTTTGGAGTTTTGAGCTAAGG - Intergenic
1081694116 11:45097822-45097844 ATGTTTGGAGGTGCCTGCAGTGG + Intronic
1082653642 11:55825524-55825546 ATGTTTTGTTGTGTGTGCTGTGG + Intergenic
1083510895 11:63208742-63208764 GTGCTTGGAGGTGAGTGTGGGGG + Intronic
1083541954 11:63517672-63517694 GTGTTTGGAGGTGGGGACTTTGG + Intergenic
1084694025 11:70743293-70743315 GTGTCTGGAGGTGGGGGCTTTGG + Intronic
1084944684 11:72632265-72632287 GTGTGTGGAGGCTTGTGGTGTGG + Intronic
1085174878 11:74476939-74476961 GTGTCTGGAGGTGTGTGAGCAGG + Intergenic
1085218478 11:74852513-74852535 GTGTGTAGAGGTTTGTGCTGAGG - Intronic
1085621908 11:78044137-78044159 CTGTTTTGGGGTGTGGGCTGGGG - Intronic
1086953624 11:92914757-92914779 GTGTCTGGAAGTGTGTGGAGGGG + Intergenic
1087384485 11:97453264-97453286 GTGTCTGGAGTTTTGTGGTGCGG + Intergenic
1087969975 11:104468493-104468515 GCGTTTGCAGGTGGGTGGTGAGG + Intergenic
1088021111 11:105120672-105120694 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1088214553 11:107493341-107493363 GTGTGTGTATGTGTGTGCAGAGG - Intergenic
1088619311 11:111665349-111665371 GGGGTAGGAGGTGTGTGGTGGGG + Intronic
1089807939 11:121108274-121108296 GTGTGTGTATGTGTGTACTGGGG - Intronic
1089877985 11:121744500-121744522 GTGGTTGGAGGGGTGTTTTGAGG - Intergenic
1089891312 11:121884220-121884242 GTGAGTGGAGCTGGGTGCTGGGG - Intergenic
1090095769 11:123741033-123741055 GTGTATCTGGGTGTGTGCTGGGG + Intronic
1090354387 11:126130100-126130122 GTGACTGGAGTGGTGTGCTGGGG + Intergenic
1091023978 11:132125857-132125879 GTGGTATGTGGTGTGTGCTGTGG + Intronic
1091107633 11:132937620-132937642 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1091408591 12:224344-224366 GAGTGGGGGGGTGTGTGCTGGGG - Intronic
1091713775 12:2761535-2761557 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1092118167 12:6024330-6024352 GTGTTTAGAGGCGTGTTTTGGGG - Intronic
1092536778 12:9396110-9396132 GTGTGTGGATGTGTGTGTTAAGG + Intergenic
1092557898 12:9577197-9577219 GTGTGTGGATGTGTGTGTTAAGG - Intergenic
1092937076 12:13374092-13374114 GTGTGTGCATGTGTGTGTTGGGG + Intronic
1094470396 12:30796659-30796681 GGGTTTGGAGCTGTGCGCTGGGG - Intergenic
1094513396 12:31110728-31110750 GTGTGTGGATGTGTGTGTTAAGG + Intergenic
1094592962 12:31838338-31838360 GTGTTAGGAGGTGAGAGCTTTGG - Intergenic
1094633725 12:32203505-32203527 GTGTTTGGAGTTCTCAGCTGAGG + Intronic
1094794840 12:33959824-33959846 GTGTTTGTGTGTGTGTGTTGGGG - Intergenic
1095211813 12:39503069-39503091 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
1096574344 12:52543379-52543401 GTGTAGGGAGGAGTGAGCTGGGG - Intergenic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1097053733 12:56238307-56238329 CTGTGTGCAGGTGTGTGTTGGGG - Exonic
1097636085 12:62123767-62123789 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1098195820 12:68001072-68001094 GTGTGTGTATGTGTGTGCTCTGG - Intergenic
1099138676 12:78941949-78941971 GTGCTGGGATGTGTGTGCAGAGG - Intronic
1099359353 12:81680669-81680691 GTGTAGGGAGGTGTGAGGTGTGG - Intronic
1100337611 12:93646846-93646868 GTATTTGGAGGTGGGTCCTTTGG + Intergenic
1100969005 12:100046570-100046592 CTGTTGGGAGGTGGGGGCTGGGG + Intronic
1101489850 12:105200503-105200525 TTTCATGGAGGTGTGTGCTGAGG + Intronic
1101576608 12:106002855-106002877 GTGTGTGTATGTGTGTGATGAGG - Intergenic
1102010931 12:109617966-109617988 CTGCTTGGACTTGTGTGCTGGGG - Intergenic
1102487952 12:113270848-113270870 GTGTTAGGAGGTGGCGGCTGTGG - Intronic
1102577155 12:113863042-113863064 TTCTTTTGAGGTGTGTGGTGGGG + Intronic
1104123600 12:125822275-125822297 GTGTTTGTAGGTGTGTGTGTTGG + Intergenic
1104242766 12:127006816-127006838 ATGTTTGTAGGTGTGTGCATAGG - Intergenic
1104282354 12:127389633-127389655 GTGTTTGGAGGTGGGGGCAGGGG + Intergenic
1104614007 12:130253656-130253678 GTGTGAGGTGGTGTGTGCTTGGG + Intergenic
1104728843 12:131094170-131094192 GTGTTTGGGGCTGGGTGCTGAGG - Intronic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1106136195 13:26975588-26975610 GTGTGTGTAGGTGTGTGTGGGGG - Intergenic
1106777007 13:33017779-33017801 GTGTTTGGAGGTCCCTTCTGCGG + Intronic
1106915311 13:34507433-34507455 GAGGCTGGAGGTGTGTGTTGGGG - Intergenic
1108019636 13:46113832-46113854 CAGTATGGTGGTGTGTGCTGAGG - Intergenic
1108555320 13:51585157-51585179 GGCTTTGCAGGTGTGTGCTTGGG + Intronic
1108614546 13:52118814-52118836 GTGTTTGTGTGTGTGTGCTGGGG - Intronic
1108676330 13:52740134-52740156 GTCTTTGTAGGTGTGTGTTGGGG + Intergenic
1110125084 13:71932491-71932513 GTGTTGGGAGGTGGGGCCTGTGG + Intergenic
1110229784 13:73155899-73155921 GTGATAGGAGGTGTGAGTTGAGG + Intergenic
1110441218 13:75527996-75528018 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1111337580 13:86842078-86842100 GTGGTTGGAGGTGGGGGATGTGG + Intergenic
1111444692 13:88331636-88331658 GTGTATGTAGATGTATGCTGAGG - Intergenic
1111822017 13:93226930-93226952 GTGCGTGGAGGTATGTGTTGGGG - Exonic
1111981861 13:95025189-95025211 GGGTGTGGGGGTGTGTGGTGTGG - Intronic
1111981884 13:95025270-95025292 GTGTGTGGGGGTGTGTGTGGGGG - Intronic
1112781320 13:102904142-102904164 GTGTTCGTTGGTGTGTGGTGAGG + Intergenic
1113217264 13:108056815-108056837 GTGGTTAGAAGTGTGTGCTTTGG + Intergenic
1113327178 13:109293540-109293562 GTGTTTGGGTGTGTGTGCATAGG - Intergenic
1113327314 13:109294533-109294555 GTGTGTTGGGGTGTGTGTTGGGG - Intergenic
1113389925 13:109885754-109885776 GTGCTTTGTGCTGTGTGCTGAGG + Intergenic
1113442633 13:110341048-110341070 GGGTGGGGAGGGGTGTGCTGGGG + Intronic
1115043525 14:28960102-28960124 CTGTCTGGGGGTGGGTGCTGGGG + Intergenic
1115379595 14:32720909-32720931 GTGTTTAGAGGTGTTTGTTTAGG + Intronic
1115413290 14:33101134-33101156 GTGTGTGCAGGTGTGTGTGGGGG - Intronic
1116492974 14:45527405-45527427 GTGTTTGTAGCTGTGTCATGCGG - Intergenic
1117055839 14:51911251-51911273 GTGTATGTATGTGTGTGCTTGGG + Intronic
1117119167 14:52550488-52550510 GTGTTTAGAGGTGGGCGGTGAGG - Intronic
1117397459 14:55325043-55325065 GTATTTGGAGGTGGGGCCTGTGG - Intronic
1117748668 14:58898105-58898127 GTATTTGGAGGTGGGGCCTGTGG - Intergenic
1119358954 14:74031750-74031772 GTATTTGGAGGTGTGACCTTTGG - Intronic
1119717078 14:76867002-76867024 GTGTGGGGGGGTGTGTGTTGGGG + Intronic
1119717144 14:76867230-76867252 GTGTGTGGGGGTGTGTGTTGGGG + Intronic
1119717163 14:76867282-76867304 GTGTTTGGGGGGGTGTGCCTAGG + Intronic
1120139744 14:80915599-80915621 GTATTTGGAGGTTTGAGTTGAGG - Intronic
1120207374 14:81601008-81601030 GTGGTTGGAAGTGTGGGCTCTGG - Intergenic
1120468372 14:84890787-84890809 GTGTTTGGAGGTGGGGACTTTGG - Intergenic
1120653819 14:87165780-87165802 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1120893620 14:89510509-89510531 GTGATCGGAGCTGTGTGCTGGGG - Intronic
1121325128 14:93015431-93015453 ATGTTGGGAGGAGTGTGCTGGGG - Intronic
1121355248 14:93208124-93208146 GTGTTTGAGGGGGTGTGATGTGG + Intronic
1122210014 14:100167723-100167745 GTGTGTTGGGGTGTGTGTTGGGG - Intergenic
1122210146 14:100168270-100168292 GTGTTGGGGTGTGTGTGTTGGGG - Intergenic
1122210149 14:100168284-100168306 GTGTTGGGATGTGTGTGTTGGGG - Intergenic
1122210160 14:100168333-100168355 GTGTTGGGGTGTGTGTGTTGGGG - Intergenic
1122210194 14:100168461-100168483 GTGTTGGGGTGTGTGTGTTGGGG - Intergenic
1122979773 14:105186275-105186297 GTGTGTGGAGGTGTGTGTGGGGG + Intergenic
1123079153 14:105683395-105683417 GTGTGTGGATGTGTGGGGTGTGG + Intergenic
1202902984 14_GL000194v1_random:53870-53892 GTGTTGGGGGGTGTGAGCTGGGG + Intergenic
1123464404 15:20504440-20504462 GTGTTTAGAGCTGTGTTGTGTGG - Intergenic
1124142248 15:27087941-27087963 GTGGTGTGTGGTGTGTGCTGTGG + Intronic
1124386223 15:29210140-29210162 GTAGTTCGAGGTGTGGGCTGTGG - Intronic
1124646989 15:31444269-31444291 GTGTGTGTAGGTGTGTGTCGGGG + Intergenic
1125338579 15:38652437-38652459 GTGTTTAGAGGTGTAGACTGCGG - Intergenic
1125476411 15:40050812-40050834 GTGTGTGGGGGTGTGTGGTGCGG + Intergenic
1125548471 15:40526227-40526249 TTGTTTGTAAGTGTGTGTTGGGG + Intergenic
1125556087 15:40586249-40586271 GGGTGTGCTGGTGTGTGCTGCGG - Intergenic
1126167209 15:45663625-45663647 AGGTGTGGTGGTGTGTGCTGTGG + Intronic
1127085036 15:55416601-55416623 TTGATTGGAGGTGGGTGGTGAGG - Intronic
1127399230 15:58569597-58569619 GTGTTTGGAGGTGGGGCCTTTGG + Exonic
1127526399 15:59796438-59796460 GTGTGTGCATGTGTGTGTTGGGG - Intergenic
1127590443 15:60416773-60416795 GTGTTGGGAGGTGTGGCCTTTGG - Intergenic
1127659147 15:61083684-61083706 GTGGGTGGAAGTGTGAGCTGAGG - Intronic
1128078474 15:64842442-64842464 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128078483 15:64842501-64842523 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1128148278 15:65344815-65344837 GTGCCTGGGGCTGTGTGCTGTGG + Intronic
1128371129 15:67040139-67040161 CAGTGTGGAGGTGAGTGCTGAGG + Intergenic
1128643933 15:69361047-69361069 CTGTTTGGTGGGGTGAGCTGAGG + Intronic
1129380296 15:75160842-75160864 GTGTTAGGAGGTGGGGGCTTTGG - Intergenic
1130834861 15:87640276-87640298 GTGCCTGTATGTGTGTGCTGGGG + Intergenic
1131022027 15:89106956-89106978 GTTTTTGGGGTGGTGTGCTGTGG + Intronic
1132162437 15:99555767-99555789 GAGTTTGCTGGTGTGTGCAGTGG + Intergenic
1132379177 15:101354364-101354386 GTGTATGGGAGTGTGTGCTTGGG - Intronic
1132570092 16:640804-640826 GTGTTGGGGGCTGTGTGCTGGGG - Intronic
1132721771 16:1320085-1320107 GTGTTGGGAGGAGGGTGATGTGG + Intronic
1133216788 16:4297411-4297433 GTGTTTGCATGTGTGTGCGTGGG - Intergenic
1134321467 16:13168155-13168177 GTGGTTGGGGGTGTGGGCTTTGG - Intronic
1134518819 16:14908494-14908516 GTGTGTGTGTGTGTGTGCTGAGG + Intronic
1134706490 16:16307149-16307171 GTGTGTGTGTGTGTGTGCTGAGG + Intergenic
1134782422 16:16910296-16910318 GTGGTGGGAGGTGTGTATTGAGG - Intergenic
1134914585 16:18059264-18059286 TTGTATGGATGTGTGTGTTGTGG + Intergenic
1134961050 16:18404975-18404997 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1134965352 16:18487578-18487600 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1135031935 16:19045468-19045490 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1135111410 16:19693267-19693289 GTATGTGGATGTGTGTGTTGCGG + Intronic
1135128602 16:19833091-19833113 GTGTGTGTATGTGTGTGGTGAGG + Intronic
1135563011 16:23491103-23491125 GTGTTTGTGTGTGTGTGTTGGGG + Intronic
1135632953 16:24050236-24050258 GTGTTTGAGGTTGTGGGCTGTGG - Intronic
1135918153 16:26624512-26624534 GTGTCTGTGTGTGTGTGCTGGGG - Intergenic
1136291909 16:29278595-29278617 GTGTTTGGAGTTGTTATCTGCGG + Intergenic
1136605723 16:31332015-31332037 GTGTGTGCATGTGTGTGCTCAGG + Exonic
1136653485 16:31693741-31693763 GTGTGTGCATGTGTGTGCTGTGG - Intergenic
1136736783 16:32474028-32474050 GAGTCTGGTGGTGTCTGCTGCGG - Intergenic
1137264658 16:46859005-46859027 GTGGTTGAGGGTGTGTACTGTGG - Intergenic
1137264664 16:46859050-46859072 GTGGTTGAAAGTGTGTACTGCGG - Intergenic
1137409545 16:48216232-48216254 CTGTTTGAAGGGGTGTGCTATGG - Exonic
1137938611 16:52658842-52658864 GTGTTTGGCAGGGTGGGCTGTGG - Intergenic
1138733363 16:59221442-59221464 CTGTTTGAAGGTGTGTTGTGGGG + Intergenic
1140059765 16:71558007-71558029 GTGTTTAGAGATGTGTACTGAGG + Intronic
1140778845 16:78275476-78275498 CTTTCTGGAGGTATGTGCTGAGG + Intronic
1141188886 16:81809185-81809207 GTGTGCAGAGGTGTGTGCTGAGG - Intronic
1141441623 16:84033032-84033054 GTGTGGGTAGGTGTGTGTTGTGG + Intronic
1141492504 16:84383743-84383765 GTGTGTGTATGTGTGTGTTGGGG + Intronic
1141686352 16:85572244-85572266 GTGTGTGGTTGTGTGTGGTGTGG - Intergenic
1141899822 16:86983851-86983873 GAGTTTGGAGGTGGAGGCTGAGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1142097801 16:88252555-88252577 GTGTTTGGAGTTGTTATCTGCGG + Intergenic
1142190279 16:88714234-88714256 GTGTGTGTGGGTGTGTGCGGGGG + Intronic
1142342377 16:89532057-89532079 GTCATTGGAGGTAGGTGCTGTGG + Exonic
1203016285 16_KI270728v1_random:355549-355571 GAGTCTGGTGGTGTCTGCTGCGG + Intergenic
1203034620 16_KI270728v1_random:628707-628729 GAGTCTGGTGGTGTCTGCTGCGG + Intergenic
1143158378 17:4853105-4853127 GTGGTTGGGGGAGTGTGGTGGGG + Intronic
1143351948 17:6295394-6295416 GGGATTGGAGGTGAGGGCTGTGG - Intergenic
1143419475 17:6777595-6777617 TTGCTTGGTGGTGAGTGCTGTGG + Intronic
1143447805 17:7019299-7019321 AGGTTTGGAGGTGCGTGCTGGGG - Intergenic
1143484556 17:7246513-7246535 GAGTTTGGAGGTTTGGGCTGGGG - Intronic
1144279264 17:13708426-13708448 CTGTTTGTAAGTGTGTGCTAAGG - Intergenic
1144647470 17:16985183-16985205 GTGTTAGGAGGTGTGGTCTTTGG + Intergenic
1144755289 17:17676497-17676519 GTGTGTGTCGGGGTGTGCTGAGG + Intergenic
1146241759 17:31235789-31235811 TTGTGTGTATGTGTGTGCTGAGG + Intronic
1146480031 17:33197644-33197666 GGGGTTGGATGTGTGGGCTGGGG + Intronic
1146908955 17:36635685-36635707 GTGTGTGTAAGTGTGTGTTGGGG - Intergenic
1146981278 17:37164088-37164110 GTGTTTGGTGGCGAGTGGTGGGG - Intronic
1147035597 17:37677679-37677701 GTGGTGGGAGGTGTGTATTGGGG + Intergenic
1147141676 17:38463972-38463994 ATGTTTGTGGGTGTGTGTTGTGG - Intronic
1147376579 17:40026277-40026299 CAGTCTGGCGGTGTGTGCTGTGG - Exonic
1147382032 17:40061970-40061992 GTGTGTGTATGTGTGTGCTGGGG + Intronic
1148330173 17:46809469-46809491 GTGTGTGTACGTGTGTGTTGGGG - Intronic
1148789829 17:50166912-50166934 GTGTGTGAAGGTGTGTGTGGGGG - Intronic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1150352828 17:64458924-64458946 GTGTTTGCACATGTGGGCTGGGG + Intronic
1150429861 17:65106430-65106452 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1150436467 17:65158041-65158063 GTGTATGTATGTGTGGGCTGGGG + Intronic
1151336190 17:73441050-73441072 GTGTCTGGAGGTCTGCTCTGGGG - Intronic
1151534777 17:74732518-74732540 GTGATTTGAGGTGCGTGGTGAGG + Intronic
1151734078 17:75927898-75927920 GTGTTTGAGTGTGTGTGGTGGGG - Intronic
1152191894 17:78893203-78893225 GTGTGTGCATGTGTGTGCAGGGG + Intronic
1152293447 17:79453690-79453712 GTGTGTGCCGGTGTGTGCAGAGG + Intronic
1152733457 17:81984995-81985017 GTGTGTGCAGGTGTGTGGGGGGG - Intronic
1152733488 17:81985225-81985247 GTGTGTGTGGGTGTGTGCGGGGG - Intronic
1153061205 18:996968-996990 TTGTATGTAGGTGTGTGTTGGGG - Intergenic
1153070138 18:1095966-1095988 GTAGGTGGAGGTGGGTGCTGGGG + Intergenic
1153614290 18:6920414-6920436 GGTTGTGGAGGTGTGTGGTGTGG + Intergenic
1153660776 18:7324288-7324310 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1154031755 18:10759225-10759247 GTGTTTGTGTGTGTGTGTTGGGG + Intronic
1154080252 18:11249146-11249168 GTGTGTGCATGTGTGTGCAGTGG - Intergenic
1155333145 18:24738139-24738161 GTGTGTGGGGGTGGGGGCTGGGG + Intergenic
1155654406 18:28177343-28177365 GTGTGTGGAGGCGGCTGCTGTGG + Exonic
1156346740 18:36263887-36263909 GTGTTTGGGGCTGGGTGCGGTGG + Intronic
1156501769 18:37564748-37564770 GTGAATGGTGGTGTGTGTTGGGG - Intronic
1157484081 18:48074556-48074578 GTGTGGGCAGCTGTGTGCTGAGG + Intronic
1157534429 18:48448053-48448075 GTGTGTGGGGGTGGGTGGTGTGG - Intergenic
1157597098 18:48870624-48870646 GTGTGTGGGTGTGTGTGATGTGG + Intergenic
1157614627 18:48979153-48979175 GTGTGTGGGTGTGTGTGATGTGG - Intergenic
1157791440 18:50535219-50535241 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1157791450 18:50535284-50535306 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1158573957 18:58620494-58620516 GTGGTTGGAGGTGAGGGCAGTGG + Intronic
1159016186 18:63103330-63103352 GTGTGTGCAGGTGTGTAGTGTGG + Intergenic
1160025903 18:75215972-75215994 GTGTTTGTGGGTGTGTGGTGGGG + Intronic
1160327653 18:77965793-77965815 GTGTTTGGAGGTGGGGTCTTTGG - Intergenic
1160363466 18:78304222-78304244 GTGTTTTCTGGTCTGTGCTGGGG + Intergenic
1160661601 19:302459-302481 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661616 19:302642-302664 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661622 19:302708-302730 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661628 19:302771-302793 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661656 19:303125-303147 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661659 19:303158-303180 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661666 19:303251-303273 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661675 19:303347-303369 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661684 19:303503-303525 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661719 19:304001-304023 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661723 19:304034-304056 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661736 19:304223-304245 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160661742 19:304289-304311 GTGTATTGAGGTGTCTGATGAGG - Intergenic
1160968987 19:1759156-1759178 GTGTATGGAGTTGCATGCTGAGG + Intronic
1161518785 19:4712038-4712060 GCGTTTGGAGGAGTTTTCTGTGG - Intronic
1162245287 19:9394936-9394958 GTCTTTGGTGGTTTGTGTTGTGG + Intergenic
1162404930 19:10467807-10467829 TTTTTTGGAGGTGGGGGCTGGGG + Exonic
1163223478 19:15938216-15938238 GTGTGTGTGTGTGTGTGCTGAGG - Intergenic
1163637150 19:18442269-18442291 GTGTGTTGGGGTGTGTGGTGTGG - Intergenic
1163642177 19:18468070-18468092 GTGTGTGGAGGGGTTTGGTGTGG - Intronic
1164840958 19:31391684-31391706 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1164868021 19:31620954-31620976 GTATTTGGAGGTGTGGCCTTTGG + Intergenic
1165077270 19:33286827-33286849 GTTTATGGAGGTGTGAGCAGGGG + Intergenic
1167072631 19:47229801-47229823 GTGTATGTATGTGTGTGGTGGGG - Intronic
1167143026 19:47665182-47665204 GTGTCTGGTGGGGGGTGCTGAGG - Intronic
1167415428 19:49368344-49368366 AGGTGTGGTGGTGTGTGCTGTGG + Intronic
1167719670 19:51169823-51169845 GTGTTTGGAGGAGTCTGTGGAGG - Intergenic
1167726385 19:51215895-51215917 GAGTCTGGAGGCCTGTGCTGGGG - Intergenic
1167735268 19:51290688-51290710 GTGTTTGGAGGTGGGGCCTTGGG + Intergenic
1167741940 19:51329128-51329150 GTGTGTGGGGGGGTGGGCTGGGG + Exonic
1167840865 19:52118467-52118489 GTATTTGGAGGTGTGGTCTTTGG + Intronic
1168414979 19:56161925-56161947 GTCTTAGGAGGTGGGTGCTGAGG - Intergenic
1168674999 19:58271303-58271325 GTGGCTGGAGGTGGGTGCAGTGG + Intronic
924991877 2:319423-319445 GTGTGTGGGGGTGTGTGCGCGGG + Intergenic
926409224 2:12584755-12584777 GTGTTTTGAGGTGGGTGGGGGGG - Intergenic
926880874 2:17542201-17542223 GTGTTTGTGTGTGTGTGGTGGGG + Intronic
927547971 2:23971627-23971649 GGGCATGGTGGTGTGTGCTGAGG - Intronic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
928628626 2:33167717-33167739 GTGTATGGAGGAATGTGCAGTGG + Intronic
929581802 2:43086054-43086076 GTGTGTGCACGTGTGTGGTGGGG - Intergenic
929603399 2:43218926-43218948 GGGTCTGGATGTGTCTGCTGCGG - Intergenic
929964995 2:46527928-46527950 GTGGCTGGAGGTGAGTGCTCAGG - Intronic
930003464 2:46877707-46877729 GTGTGTGGGTGTGTGTGGTGTGG - Intergenic
930607338 2:53506051-53506073 GTGTTTAGAGTTTTGAGCTGAGG - Intergenic
931181709 2:59908345-59908367 GTGCTTGGGTGTGTGTGTTGTGG - Intergenic
932188497 2:69718644-69718666 GTGTATGCATGTGTGTGCTGTGG - Intronic
933214623 2:79615824-79615846 GTGTTTGTATGTGCGTGTTGGGG + Intronic
934032525 2:88061161-88061183 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934032531 2:88061199-88061221 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
934046303 2:88175392-88175414 GTGTTTGGAGGTGTGTGCTGAGG + Exonic
934114621 2:88775228-88775250 GTGTTTGGGGGTTTCTGATGAGG + Intergenic
934180778 2:89617791-89617813 GTGTTTGGAGGTGTGGGAATAGG - Intergenic
934286744 2:91657414-91657436 GAGGGTGGGGGTGTGTGCTGGGG - Intergenic
934291077 2:91692027-91692049 GTGTTTGGAGGTGTGGGAATAGG - Intergenic
934513517 2:94968251-94968273 GTGTTAGGAGGTGGGGGCTTTGG - Intergenic
934632013 2:95936628-95936650 GTGTTTGGGGGTTTCTGATGAGG - Intronic
934801490 2:97166593-97166615 GTGTTTGGGGGTTTCTGATGAGG + Intronic
935420397 2:102862461-102862483 GTATTTGGAGGTGTGGGCTTTGG - Intergenic
935546902 2:104409656-104409678 GGGGTTAGAGGTGTGTGATGCGG + Intergenic
935594526 2:104868578-104868600 GTGTCTGGAGGTCTGGCCTGAGG - Intergenic
935715563 2:105936250-105936272 GTGTATGGATGTGTGTGTGGTGG - Intergenic
935944954 2:108277353-108277375 GTGTTTGGAGGTGGAGGCAGAGG - Intergenic
936107303 2:109635953-109635975 GTGTTAGGAGGTGGGGGCTTTGG + Intergenic
936611543 2:114006576-114006598 GTGTTTGCAGAAGTGTGCTGTGG - Intergenic
937173634 2:119903492-119903514 GTGTCTGGAGGTGGTAGCTGAGG - Intronic
937216174 2:120315042-120315064 GTGTGTGGACGAGTGTGCCGGGG - Intergenic
938236627 2:129711054-129711076 GTGTTTGGAGGTTTTGACTGCGG - Intergenic
938768522 2:134480176-134480198 GTGTTAGGAGGTGAGGGCAGAGG - Intronic
940316241 2:152330581-152330603 GTGTTTGGAGTTCTGAGCTAAGG + Intergenic
940717982 2:157249450-157249472 GTGTTTGGAAAGGTGTCCTGGGG - Intergenic
941687830 2:168465447-168465469 GTGTTAGGAGGTGGGGCCTGTGG - Intronic
941943347 2:171067758-171067780 CTGTTTTGAGGTGGGGGCTGAGG - Intronic
942618520 2:177821413-177821435 GGGTTTGGAGGTGGCTTCTGGGG - Intronic
943899138 2:193409404-193409426 CTGTTTGGAGGTGGGAGGTGAGG + Intergenic
943986707 2:194631038-194631060 GTCTTTGGATGTGTGTGGTGGGG + Intergenic
944083603 2:195818695-195818717 GTGTGTGGATGAGTGTGCAGAGG - Intronic
946118697 2:217489690-217489712 GTGGTGGGAGGTCTGAGCTGGGG - Intronic
946427204 2:219605735-219605757 GTGAGTGGGGGTGTGTGATGGGG + Intronic
947156086 2:227164299-227164321 GCGTTTGGGGGTGTGCGGTGGGG - Intergenic
947673568 2:231958402-231958424 GTATTTGGAGGTGGGGGCTTTGG + Intergenic
948261482 2:236607328-236607350 GTGTTGTGGGGTGCGTGCTGCGG - Intergenic
948304739 2:236938265-236938287 GTGTGTGCATGTGTGTGGTGTGG + Intergenic
948568719 2:238903074-238903096 GTGATGTGGGGTGTGTGCTGTGG + Intronic
948985152 2:241517084-241517106 GTGTTGGGGTGTGTGTGTTGGGG - Intergenic
949050834 2:241896541-241896563 GTGTTGGGGTGTGTGTGTTGGGG + Intronic
1168803928 20:662062-662084 GCGCGTGGAGGTGTGTGCTTCGG + Exonic
1169877532 20:10314312-10314334 GTGTCTGGGGGTGTGGGGTGTGG + Intergenic
1170473137 20:16688231-16688253 GAGTTTGGTAGTGGGTGCTGGGG + Intergenic
1170909310 20:20548791-20548813 GTAATTACAGGTGTGTGCTGAGG - Intronic
1171109997 20:22472061-22472083 GTGTGTGGTGGTGTGTGTGGTGG - Intergenic
1171142461 20:22755027-22755049 GTGCCTGGAGGAGTGGGCTGAGG + Intergenic
1171175012 20:23045205-23045227 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1171179082 20:23078563-23078585 GTGTGTGGGTGTGTGTGTTGGGG + Intergenic
1171502090 20:25601691-25601713 GTGTATGTAGGTGTGTGGAGAGG - Intergenic
1171502098 20:25601781-25601803 GTGTATGTAGGTGTGTGGAGAGG - Intergenic
1172166235 20:32901161-32901183 TTGCTTGGAGCTGTTTGCTGAGG + Intronic
1172486850 20:35303659-35303681 GGGTTGGGGAGTGTGTGCTGGGG + Exonic
1172908785 20:38389892-38389914 GTATTTGGAGATGTGTCCTTTGG - Intergenic
1172936997 20:38627537-38627559 GTGTGTGTTGGTGTGTGTTGGGG + Intronic
1173473245 20:43339514-43339536 GTGTGTGGAGGTAGGTGCTGAGG - Intergenic
1173551320 20:43934824-43934846 GTATGTGGGGGTGTGTGTTGGGG + Intronic
1173783740 20:45777150-45777172 GTGTGAGGAGCTGTGTGATGGGG - Exonic
1174490037 20:50886379-50886401 GTTTTTGGAGGAGAGTGCGGAGG + Intergenic
1175172621 20:57091044-57091066 GTGGGTGGAGGTGTGTGTGGTGG - Intergenic
1175172628 20:57091075-57091097 GTGGGTGGAGGTGTGTGCATGGG - Intergenic
1175172646 20:57091161-57091183 GTGGGTGGAGGTGTGTGCATGGG - Intergenic
1175593320 20:60211153-60211175 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1176062859 20:63179827-63179849 GGGGCTGGAGGTCTGTGCTGAGG - Intergenic
1176622347 21:9068637-9068659 GTGTTGGGGGGTGTGAGCTGGGG + Intergenic
1178710045 21:34908953-34908975 GTGTGTGTATGTGTGTGCTAGGG + Intronic
1178911973 21:36682083-36682105 GTGTGTGGGTGTGTGTGATGTGG + Intergenic
1179532164 21:42027239-42027261 GTGTGTGTGGGTGTGTGATGTGG + Intergenic
1179675129 21:42975372-42975394 GTGTTTGGGGCCGGGTGCTGGGG + Intronic
1180074470 21:45455697-45455719 GTGTGTGGTGGTATCTGCTGTGG - Exonic
1180535766 22:16391889-16391911 GAGTCTGGTGGTGTCTGCTGCGG + Intergenic
1180784567 22:18539621-18539643 GTGTTGGGTGCTGTGAGCTGGGG + Intergenic
1181025007 22:20123033-20123055 GTGGTTGGGGGTGTGTGGTTGGG + Intronic
1181025024 22:20123116-20123138 GTGTCTGAAGGTGTGTGGTCTGG + Intronic
1181241470 22:21478978-21479000 GTGTTGGGTGCTGTGAGCTGGGG + Intergenic
1182108368 22:27705141-27705163 GTGTTAGGAGGTGGGTCCTTTGG - Intergenic
1182423094 22:30257949-30257971 AGGTTTGGAGGTGGCTGCTGGGG - Intergenic
1182754692 22:32669263-32669285 GGGATGGGAGGTGTGTGTTGGGG + Intronic
1183062139 22:35342707-35342729 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062151 22:35342778-35342800 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062187 22:35343021-35343043 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062206 22:35343144-35343166 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062221 22:35343242-35343264 GTGTGTGGAGGTGTGTGTGGTGG - Intronic
1183062252 22:35343439-35343461 GTGTGTGTAGGTGTGTGTGGTGG - Intronic
1183062263 22:35343544-35343566 GTGTGTGTAGGTGTGTGTGGTGG - Intronic
1183343673 22:37295363-37295385 GTGTGTGCATGTGTGTGGTGGGG - Intronic
1183426732 22:37743873-37743895 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1183574794 22:38681194-38681216 GTGGTTGGTGGTGCATGCTGAGG + Intergenic
1184148706 22:42626399-42626421 GTGTTCGGAGGTATGAGATGAGG + Intronic
1184397414 22:44251078-44251100 CTGGATGGAGGTGTGTGCTATGG - Intronic
1184688680 22:46107776-46107798 GTGTTGTGGGGTGTGTGCGGGGG - Intronic
1184946872 22:47809938-47809960 GTGTATGTATGTGTGTGCTGTGG + Intergenic
1185101830 22:48844723-48844745 GTTTTTGGCGCTGGGTGCTGGGG - Intronic
1185107397 22:48881721-48881743 GTATGTGGTGGTGTGTGATGTGG - Intergenic
1185193005 22:49450659-49450681 GTGTTTAGATGTGTGTGTTTAGG - Intronic
1185212704 22:49580348-49580370 GTGTGTGTGGGTGTGTGGTGTGG - Intronic
949256534 3:2053945-2053967 GTATTTGGAGGTGGGGCCTGTGG + Intergenic
949363128 3:3252763-3252785 GTGTTTGGGTGTGTGTAGTGGGG - Intergenic
950139653 3:10606597-10606619 GTGGGTGGACGTGTGTGCAGCGG + Intronic
950627060 3:14254986-14255008 GTGTTTTAAGGCGTGTGTTGGGG + Intergenic
950627086 3:14255145-14255167 GTGTTGGGGTGTGTGTGTTGGGG + Intergenic
950627139 3:14255581-14255603 GTGTGTTGGGGTGTGTGTTGAGG + Intergenic
950676818 3:14559037-14559059 GTGTTTAATGGTGTGGGCTGTGG + Intergenic
951080169 3:18444145-18444167 GTGCCTGGAGGAGTGGGCTGCGG - Intronic
952266570 3:31792593-31792615 GTGTATGAGGGTGTGTGCTGGGG + Intronic
952276581 3:31883185-31883207 GTGTCTGCAGGTGTGTGTAGGGG - Intronic
952616177 3:35276636-35276658 GTGTGTGCAGGTGTTAGCTGTGG - Intergenic
952880307 3:37981402-37981424 GTGTGTGGCGGGGGGTGCTGAGG + Exonic
952884009 3:38001917-38001939 GTGCTTAGAAGTGTGTGCGGGGG - Intronic
953020310 3:39108864-39108886 GAGTTTGGAGGTGTTTGTTTGGG - Intronic
953922357 3:46960936-46960958 GGGTTTGTAGGTGTGGGTTGGGG + Intronic
954646202 3:52133089-52133111 GTGTTGGGAGGTGTGGCCTTTGG + Intronic
954981033 3:54745369-54745391 GTGATTGGAGGCATGGGCTGTGG + Intronic
956164357 3:66385144-66385166 GTGTTTGGAGGAGGGGGGTGGGG - Intronic
956369196 3:68539704-68539726 GTGTGTGCATGTGTGTGGTGGGG + Intronic
959245561 3:103863153-103863175 TGGTTTGGAGTTGAGTGCTGTGG - Intergenic
960986400 3:123284053-123284075 GTGCGTGGAGGTGTGGGCAGAGG + Exonic
961147875 3:124610557-124610579 GTGGTTGGGGGTGTGGGCTCTGG + Intronic
961427020 3:126856389-126856411 GTGTTTGGAGTTCTGAGCTAAGG - Intronic
961485388 3:127212348-127212370 GTGTCTGGAGGTGGGGGATGGGG - Intergenic
961790113 3:129369524-129369546 GTGTTTTGATGTGTGTGGTGTGG + Intergenic
961793766 3:129394831-129394853 GTGTGTGTATGTGTGTGCAGGGG - Intergenic
962889299 3:139657502-139657524 GTGTAGTGGGGTGTGTGCTGTGG + Intronic
963885849 3:150581663-150581685 GTGTTTCGTGGTGTGCTCTGTGG - Exonic
964356242 3:155854276-155854298 GAGGCTGGAGGTGTGTGCCGTGG + Exonic
964527743 3:157632969-157632991 GTGTGTGTATGTGTGTGGTGGGG - Intronic
964655220 3:159059268-159059290 GTGCTTGGAGGAGAGTCCTGTGG + Intronic
964809337 3:160646485-160646507 GTGTGTGGGTGTGTGTGTTGGGG - Intergenic
965093072 3:164186128-164186150 GTATTTGTTGGTGTGTGCTTGGG + Intergenic
965543819 3:169895591-169895613 GTGTGTGTCTGTGTGTGCTGGGG + Intergenic
965697849 3:171427985-171428007 GTGTTTGGTGCTGGGGGCTGGGG + Intronic
965937606 3:174133875-174133897 GTGTTTTGTGGGGTGTGGTGGGG - Intronic
966226367 3:177602530-177602552 GTGTTTGTGTGTGTGTGTTGGGG + Intergenic
966318080 3:178671109-178671131 GTGTTTGTACGTGTGTTTTGGGG - Intronic
966639937 3:182178369-182178391 AAGTTTGGAGATGTGTCCTGAGG + Intergenic
966857125 3:184202430-184202452 GTGTGTGCATGTGTGTGCAGTGG - Intronic
967560299 3:190910053-190910075 GTGTGTGGGGGTGTGGGGTGGGG + Intergenic
967815149 3:193792164-193792186 GTGTGTGGCGGGGTGTGGTGGGG + Intergenic
968298245 3:197593701-197593723 GTGTTTGGAGTTCTGAGCTAAGG + Intergenic
968551302 4:1225093-1225115 GTGTGAGGCTGTGTGTGCTGTGG + Intronic
968635561 4:1676771-1676793 GTATTGGGAGGTGTGGGGTGGGG - Intronic
968637754 4:1690803-1690825 GTGTGTGCATGTGTGTGGTGGGG - Intergenic
968802875 4:2755224-2755246 GTGTTTTGAGGTGTGTGTGCGGG - Intronic
968919918 4:3517155-3517177 GGGTTTGGGGGTGGGTGGTGAGG + Intronic
969482300 4:7453222-7453244 GGGTTAGGAGCTGTGTGTTGGGG + Intronic
969482526 4:7454302-7454324 GGGTTAGGAGCTGTGTGTTGGGG + Intronic
969572211 4:8015685-8015707 GTGGTGGGAGGTGTGTGTTGGGG + Intronic
970136347 4:12928860-12928882 GTATTTGGAGGTGAGTCCTTTGG - Intergenic
970373769 4:15435677-15435699 GTGTTGGGAGGGGTGTGGTTTGG - Intronic
971036609 4:22700429-22700451 GTATTTGGAGGTGGGGGCTTTGG + Intergenic
971520080 4:27538409-27538431 GTGTTTGGAGTTCTGAGCTGAGG - Intergenic
971618680 4:28827693-28827715 GTGTGTGTAAGTGTGTGGTGAGG - Intergenic
972940123 4:44185866-44185888 GTGTTTGTGTGTGTGTGGTGGGG - Intronic
973084372 4:46037043-46037065 GTGTTTAGAGATGCGAGCTGGGG - Exonic
973850648 4:54958208-54958230 CTGCTTAGAGGTGTGTGCTATGG - Intergenic
973862271 4:55077587-55077609 GTGTTGGGGGGTGTGTGTGGAGG + Intergenic
974080016 4:57202514-57202536 GGGCATGGTGGTGTGTGCTGTGG + Intergenic
974229500 4:59091719-59091741 GTGTTTGGGGGGTGGTGCTGAGG + Intergenic
974920775 4:68236640-68236662 CTGTTTTGAGGAGGGTGCTGAGG - Intronic
975601784 4:76107943-76107965 GTGTGTGCATGTGTGTGTTGGGG + Intronic
976059197 4:81106737-81106759 GTATTTGGAGGTGAGGCCTGTGG + Intronic
977246025 4:94632528-94632550 GTGTTGGGAGATGTGTGGTAGGG + Intronic
980343289 4:131579845-131579867 GTCCCTGGAGTTGTGTGCTGAGG + Intergenic
981017587 4:139989832-139989854 GTGTTTGTTTGTGTGTGGTGGGG - Intronic
981150563 4:141376065-141376087 GTGTTTGCAGGAGTGCTCTGGGG + Intergenic
981605818 4:146538964-146538986 GTGTTGGGAGGTGTGGCCTTGGG - Intergenic
981761694 4:148201972-148201994 GTATTTGTAGGTGTCTGCTGTGG - Intronic
981806791 4:148725176-148725198 GTATTTGGAGGTGGGACCTGTGG - Intergenic
981937405 4:150251303-150251325 GTATGTGGGGGTGTGTGGTGTGG - Intronic
981937426 4:150251370-150251392 GTGTGTGGGGATGTGTGGTGTGG - Intronic
981968299 4:150633739-150633761 GTGAGTGGATGTGTGTACTGTGG - Intronic
982057148 4:151563265-151563287 GTGCATGTAGGTGTGTGGTGTGG - Intronic
982200950 4:152959725-152959747 GTGTATGTAGGTGTGTGCATGGG + Intronic
982325531 4:154125296-154125318 GTGCTTAGGGGTGTGAGCTGTGG + Intergenic
982493833 4:156065172-156065194 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
982868609 4:160548959-160548981 GTGTGTGGATGTGTGGTCTGGGG + Intergenic
983743022 4:171158932-171158954 GTGGTGGGAGGTGCGGGCTGGGG - Intergenic
983846240 4:172523048-172523070 ATGTTTAGAGATGTGTGCTTAGG - Intronic
983856174 4:172648055-172648077 GTTTATGGAGGTGTGGGCTCCGG + Intronic
984282443 4:177687772-177687794 GTGTTTGGAGGTGGGGCCTTTGG + Intergenic
984476766 4:180245181-180245203 GTGTTTGGGGGTGGTTGCTTGGG - Intergenic
984603853 4:181760955-181760977 GTGTGTGTATGTGTGTGGTGGGG - Intergenic
985564849 5:610397-610419 GTGTGCAGAGGTGTGTGCAGGGG - Intergenic
985564875 5:610534-610556 ATGTGTAGAGGTGTGTGCAGGGG - Intergenic
985730533 5:1544946-1544968 GTGTTTGGAGGTGTGTGTGCAGG - Intergenic
985730547 5:1545067-1545089 GTGTTTGGAGGTGTGTGTGCAGG - Intergenic
985730604 5:1545634-1545656 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985730616 5:1545740-1545762 ATGTGTGCAGGTGTGTGCAGAGG - Intergenic
985776019 5:1842766-1842788 GTCTGTTGCGGTGTGTGCTGGGG + Intergenic
985776030 5:1842819-1842841 GTCTGTTGCGGTGTGTGCTGGGG + Intergenic
985776054 5:1842930-1842952 GTCTGTTGCGGTGTGTGCTGGGG + Intergenic
985776078 5:1843041-1843063 GTCTGTTGCGGTGTGTGCTGGGG + Intergenic
985776091 5:1843094-1843116 GTCTGTTGCGGTGTGTGCTGGGG + Intergenic
985776102 5:1843147-1843169 GTCTGTTGCGGTGTGTGCTGGGG + Intergenic
985776113 5:1843200-1843222 GTCTGTTGCGGTGTGTGCTGGGG + Intergenic
985984963 5:3507438-3507460 GTGTTGAGAGGAGTGTGCTTAGG + Intergenic
986010126 5:3706599-3706621 CTGTTTGGTGATGTGTGTTGGGG + Intergenic
986489267 5:8272539-8272561 GTGTTCAGAGGTGATTGCTGAGG + Intergenic
987144663 5:14980728-14980750 CTGTTTGGTTGTGTGGGCTGTGG - Intergenic
987364425 5:17136332-17136354 GTGTTGGGAGGTGGGGCCTGTGG - Intronic
989129866 5:38096581-38096603 GTGCATGCATGTGTGTGCTGGGG + Intergenic
989155478 5:38340827-38340849 GTGTTTGTATGTGTGTGTTTGGG + Intronic
989823777 5:45828526-45828548 GTGTTTGTGTGTGTGTGTTGGGG - Intergenic
990448471 5:55914671-55914693 TTGTTTTGCGGTGTGTGTTGGGG - Intronic
990714544 5:58622271-58622293 GTGGTTGGGAGTGTGTGCTCTGG + Intronic
992131692 5:73699187-73699209 GTGTTTGTGTGTGTGTGGTGGGG + Intronic
992162067 5:74013643-74013665 GGGAGTGGAGGTGTGTGATGAGG - Intergenic
992205775 5:74429282-74429304 GGGTTTGGAGGAGGGTCCTGGGG - Intergenic
992207926 5:74449026-74449048 GTGTTTGGAGATGTGGCCTTTGG - Intergenic
992408832 5:76485085-76485107 GTGCTGGGAGGTGTGAGCTATGG + Intronic
992773683 5:80071641-80071663 GTGTGTGTATGTGTGTGTTGGGG - Intronic
993206267 5:84883486-84883508 GTGTATGTATGTGTGTGTTGGGG + Intergenic
993806396 5:92416071-92416093 GTGTTGGCAGGTGTGTGCGTAGG - Intergenic
994343083 5:98654733-98654755 GTGTTTGGAGGTGGGGCCTTTGG - Intergenic
995152001 5:108859359-108859381 TTGGTTGGAGGTGGGTGTTGGGG - Intronic
995507855 5:112879320-112879342 GTGTTTGGGGGGGGGGGCTGGGG + Intronic
996058634 5:119008300-119008322 GTGTTTGGAGGTGGGGCCTTTGG - Intergenic
996145861 5:119975306-119975328 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
997232034 5:132252476-132252498 GTCTGTGGATGTGTGCGCTGGGG + Intronic
997443489 5:133925308-133925330 GGATTTGGAGGTGGGGGCTGAGG - Intergenic
998420022 5:141976417-141976439 GGGGGCGGAGGTGTGTGCTGGGG + Intronic
998560385 5:143166045-143166067 GTGTTTGGAGGGTTGTACTGAGG + Intronic
999250004 5:150176884-150176906 CTGTTTGCATGTGTGTGTTGGGG + Intronic
999270984 5:150296281-150296303 GTGTGTGCATGTGTGTCCTGGGG - Intergenic
999464883 5:151793428-151793450 ATGTTTTGAGGTGTGGGCTGTGG + Intronic
999731529 5:154479261-154479283 GTGTCTCGAGGTGTGAGCTTCGG - Intergenic
1000895230 5:166847275-166847297 GTGTGTGCACGTGTGTGTTGGGG + Intergenic
1001001646 5:168013099-168013121 GTGTGTGTAAGTGTGTGTTGGGG - Intronic
1001091708 5:168746695-168746717 GGGTGTGGTGGTGTGTGGTGTGG + Intronic
1002160165 5:177310366-177310388 GTGTATGGAGGGCTGTGCTATGG - Intronic
1002172886 5:177385225-177385247 GTGGCTGCAGGTGTGGGCTGGGG - Intronic
1002956565 6:1871053-1871075 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1003251039 6:4429492-4429514 GTGGTTGGAGGTGTGGGCTCTGG - Intergenic
1003517141 6:6826735-6826757 CTGTTTGTAGCTCTGTGCTGGGG + Intergenic
1003734429 6:8862348-8862370 GTGTTTGTATGTGTGTGCGTTGG - Intergenic
1004886046 6:20052462-20052484 GTGTATGGAGGTGTGTATTTTGG - Intergenic
1005199254 6:23324705-23324727 GTGTGTGTATGTGTGTGTTGGGG - Intergenic
1005672740 6:28123646-28123668 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1005880203 6:30051771-30051793 GTGTTTGTGGGTGTGTGAGGGGG - Intergenic
1006337672 6:33428834-33428856 GTGTCTGGATGTGGGTGGTGTGG + Intronic
1006416047 6:33904500-33904522 GGGTTGGGAGGTGTGTCTTGAGG + Intergenic
1006520267 6:34567254-34567276 GTGTGTGTATGTGTGTTCTGAGG - Intergenic
1007325743 6:41058273-41058295 GTGTGTGTGGGTGTGTGGTGGGG - Intronic
1007368742 6:41412682-41412704 TTGCTTGGAGGTGAGTTCTGAGG - Intergenic
1007384260 6:41510047-41510069 GTGTGTGTACGTGTGTGTTGGGG - Intergenic
1007410036 6:41656181-41656203 GTGTGTGTGTGTGTGTGCTGGGG - Intergenic
1007482068 6:42156819-42156841 GTGTTTGAAGGTCTGAGCTCTGG - Intronic
1007573130 6:42907584-42907606 ATGTGTGGGAGTGTGTGCTGAGG + Intergenic
1007697852 6:43744877-43744899 GTGTTTTGAGGGGAGGGCTGGGG + Intergenic
1008289503 6:49696475-49696497 GTGTTTGTAGGAGTGTGCTTAGG + Intronic
1008506345 6:52234508-52234530 GTCTTTGGAGATGTGCGGTGCGG + Intergenic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009752500 6:67890073-67890095 GTGTGTGGCTGTGTGTGGTGGGG - Intergenic
1010080661 6:71857112-71857134 GTGTTTGGAGGTGGGGCCTTTGG + Intergenic
1010088858 6:71954841-71954863 GTGTGTGTGTGTGTGTGCTGAGG - Intronic
1011651308 6:89508981-89509003 GTGTGTGGAGCTGTTTGTTGAGG + Intronic
1012560314 6:100572154-100572176 GTGTTTGGAAGTGGGGGCTTTGG + Intronic
1012616396 6:101283951-101283973 GTCTTTGTAGGGCTGTGCTGGGG - Intergenic
1012635912 6:101541361-101541383 GTGTGTGGTTGTGTGCGCTGGGG - Intronic
1014568851 6:122984681-122984703 GTGTTTGGAGGTGGGGCCTTTGG - Intergenic
1015797231 6:137025218-137025240 GTGTTTGGAGGTGGGGCCTTTGG + Intronic
1016837050 6:148488134-148488156 GTGTGTGGAGGTGGGTGAGGCGG - Intronic
1016844569 6:148558102-148558124 GTATTTGGAGGTGGGGCCTGTGG + Intergenic
1017222806 6:151986069-151986091 GTGTTTTGATGTGTGTGGTCTGG + Intronic
1017406956 6:154129847-154129869 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1017543505 6:155427013-155427035 GTGTGTGTGTGTGTGTGCTGGGG + Intronic
1017676198 6:156816706-156816728 GGGTTTGGAGTTGTGTGCTCAGG + Intronic
1017918660 6:158853089-158853111 GTGTTTGTATGTGTGTGGTGGGG - Intergenic
1018637374 6:165875093-165875115 GGGATTGTTGGTGTGTGCTGGGG + Intronic
1018756716 6:166856216-166856238 GTGTTAGGAGGTGAGAACTGTGG + Intronic
1018786418 6:167111743-167111765 GTGATCTGAAGTGTGTGCTGAGG + Intergenic
1019006353 6:168799901-168799923 GTCTAGGGAGGTGTGGGCTGCGG - Intergenic
1019121492 6:169808424-169808446 GTGCTTGGACGTCGGTGCTGGGG - Intergenic
1019125665 6:169838778-169838800 GTGCTGGGAGGTGCGGGCTGTGG - Intergenic
1019407805 7:892971-892993 GTGTTTGCAGGTAAGTGTTGGGG + Intronic
1019440227 7:1042231-1042253 GTGTTTGTGGCTGTGTGCCGTGG - Intronic
1019553816 7:1618675-1618697 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019553836 7:1618785-1618807 GTGTGTGTAGGTGTGTGGAGGGG + Intergenic
1019553871 7:1619022-1619044 GTGTGTGTAGGTGTGTGTAGGGG + Intergenic
1019581672 7:1766998-1767020 GTGTGTGTGTGTGTGTGCTGGGG + Intergenic
1019665156 7:2248296-2248318 GTGTTCAGAAGTGTCTGCTGAGG + Intronic
1019896622 7:3988259-3988281 GGGTGTGGAGGTGGGGGCTGGGG - Intronic
1020209516 7:6148195-6148217 GGGTATGGTGGTGTGTGCTGTGG + Intronic
1021291299 7:18848385-18848407 GTGTTTGGAGCTGGGGCCTGTGG + Intronic
1021502979 7:21350360-21350382 GTGTTCGGAGTTCTGTGCTAAGG + Intergenic
1021606270 7:22412472-22412494 GTTCTTGGAGCTGTTTGCTGCGG - Intergenic
1021919190 7:25466614-25466636 GTGTTTGGAGGTGGGAACTTTGG + Intergenic
1022591898 7:31671573-31671595 CAGTTTGGAGGGGTGTGGTGGGG - Intergenic
1023663899 7:42499852-42499874 TTGTTTGTATGTGTGTGTTGGGG - Intergenic
1024293700 7:47826251-47826273 GCCTTTGGAGGTGTGTGTGGTGG + Intronic
1024684450 7:51730265-51730287 ATGTGTGTAGGTGAGTGCTGGGG - Intergenic
1024818745 7:53302656-53302678 GTGTTTGGAGCTGAGTGGGGAGG - Intergenic
1025652540 7:63484072-63484094 GTGTGTGTAGGTGTGTGTGGGGG + Intergenic
1026056572 7:66989626-66989648 GTGTTTGAAGCTGTGGGGTGAGG + Intronic
1026099190 7:67370642-67370664 TTTTTTGGAGGGGGGTGCTGGGG - Intergenic
1026721525 7:72835435-72835457 GTGTTTGAAGCTGTGGGGTGAGG - Intergenic
1026819361 7:73536645-73536667 GTGTGCAGATGTGTGTGCTGAGG + Exonic
1027051712 7:75025139-75025161 GGGTTTGGGGGTGAGTACTGTGG + Intergenic
1027318272 7:76997510-76997532 GTGTGTGGAGGTGTGGAGTGTGG + Intergenic
1027318408 7:76998112-76998134 GTGTGTGGAGGTGTGGAGTGTGG + Intergenic
1027318413 7:76998136-76998158 GTGTGTGGAGTTGTGAGGTGTGG + Intergenic
1028895865 7:96040861-96040883 GGGCATGGTGGTGTGTGCTGTGG - Intronic
1029021200 7:97366149-97366171 GTGTTTGCTGGTATTTGCTGAGG - Intergenic
1029130004 7:98322666-98322688 GTGGTGGGACGTGAGTGCTGGGG - Intronic
1029439748 7:100580538-100580560 GTGTTTGGGTGTGTGTTGTGTGG - Intronic
1029447251 7:100620683-100620705 GTGTGTGGATATCTGTGCTGGGG + Exonic
1031636812 7:124110648-124110670 GGGTATGGTGGTGTGTGCTGTGG + Intergenic
1032023366 7:128422163-128422185 GTGTGTGTATGTGTGTGGTGTGG + Intergenic
1032081027 7:128858545-128858567 GTGGCTGGAGGTGGGGGCTGAGG - Exonic
1032532585 7:132634457-132634479 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1033036274 7:137878905-137878927 GTGTGTGGGGGTGGGTGGTGGGG + Exonic
1033152909 7:138931956-138931978 GTTCCTGGAGGTGTGTGGTGGGG + Intronic
1033422498 7:141216467-141216489 GTGTGTGTGGGTGTGTGGTGGGG + Intronic
1034869547 7:154671849-154671871 GTGTGTGCATGTGTGTGTTGGGG - Intronic
1035298298 7:157879338-157879360 GTGTTTGGGTGTGCGTGTTGGGG - Intronic
1035368733 7:158364966-158364988 GTGTGTGAATGTGTGTGTTGTGG - Intronic
1035898628 8:3433460-3433482 GTGGTTGGTGTTGTGTGGTGTGG + Intronic
1036018440 8:4814242-4814264 GTGTGTGTATGTGTGTGGTGGGG + Intronic
1037275631 8:17175122-17175144 CTGTTTAGAGATGTGTTCTGAGG + Intronic
1037607624 8:20450659-20450681 GTGTTTGGAGGTGGGGCCTTTGG + Intergenic
1037624670 8:20596379-20596401 GTGTTTCCAGGTGAGAGCTGTGG + Intergenic
1037817925 8:22121456-22121478 GTGTTTGGAGGCATGTCCTGAGG + Intronic
1038078099 8:24100874-24100896 CTCTTTGCAGGTGTGTGTTGGGG + Intergenic
1039821238 8:41137285-41137307 GAGGTGGGAGGTGTGTGATGGGG - Intergenic
1041105895 8:54443783-54443805 CTCTTTGAAGGTGTTTGCTGAGG - Intergenic
1041115292 8:54530032-54530054 ATGTTTGGAGGTGGGACCTGTGG - Intergenic
1042064708 8:64861368-64861390 CTGTTTGGGGGTGTGTGGTGGGG + Intergenic
1042099337 8:65257635-65257657 GTGGTGAGAGGTGTGTGTTGAGG - Intergenic
1042575984 8:70219446-70219468 TGGGTTGGAGGTGTGTACTGGGG - Intronic
1043467693 8:80528717-80528739 GTGTTTGGTGGTGGGGGTTGGGG - Intergenic
1044700062 8:94957694-94957716 GTGTTTGGAGTTACGAGCTGAGG + Intronic
1045675376 8:104601618-104601640 GTATTTGGAGGTGGGGCCTGTGG - Intronic
1045844864 8:106622448-106622470 GTGTGTGTGTGTGTGTGCTGGGG - Intronic
1047591742 8:126334428-126334450 GTGTGTGTGTGTGTGTGCTGTGG - Intergenic
1047610187 8:126513196-126513218 GTGTTTGGAGGTGGGACCTATGG - Intergenic
1048040013 8:130717981-130718003 GTGTTGGGAGGTGGGTCCTTTGG + Intergenic
1048254127 8:132892655-132892677 GTGTGTGTATGTGTGTGCTGTGG + Intronic
1048254142 8:132892825-132892847 GTGTGTGTATGTGTGTGGTGTGG + Intronic
1048628751 8:136217100-136217122 GAGTTTAGAGGTGTTTGCTTAGG - Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1048923024 8:139247703-139247725 GTATTGTGAGGTGTGGGCTGCGG + Intergenic
1049130841 8:140839130-140839152 GTGTTAGTGTGTGTGTGCTGGGG - Intronic
1049607263 8:143535569-143535591 GTGGTTGGGGGTATGTGGTGAGG - Intronic
1050042078 9:1506611-1506633 GTGTGTGCACGTGTGTGGTGTGG + Intergenic
1050221169 9:3391862-3391884 ATGTTTGGAGGTTTGTTCTTTGG + Intronic
1050565573 9:6878740-6878762 GTGTATGTATGTGTGTGATGAGG + Intronic
1050639422 9:7651370-7651392 GTGTTTGGAGGTGGGACCTTTGG + Intergenic
1051114935 9:13683816-13683838 GTGTTTGGAGGTGGGACCTTTGG - Intergenic
1051392648 9:16582382-16582404 CTCTGTGTAGGTGTGTGCTGGGG - Intronic
1051746134 9:20297088-20297110 GTGTTTGGAATTGTGTCCTTTGG + Intergenic
1051811555 9:21055168-21055190 GTGTTTGGAGTTCTGAGCTAAGG + Intergenic
1052457083 9:28713672-28713694 GTGTGTGGAGGGGTGTGGTCAGG + Intergenic
1052861698 9:33441724-33441746 GTGTGTGCATGTGTGTGCAGGGG - Exonic
1053273233 9:36764620-36764642 GTGTGCTGTGGTGTGTGCTGTGG + Intergenic
1053406006 9:37876731-37876753 GTATTTGGAGGTGAGGGCTTTGG + Intronic
1056578991 9:87876705-87876727 GTGTTCTGAGGTGAGTTCTGTGG + Intergenic
1056754268 9:89372332-89372354 GTGTGTGGGGGGGTGTGGTGTGG + Intronic
1057295300 9:93831128-93831150 GTCTTAGGAGGTGAGTGCTGAGG - Intergenic
1057397935 9:94696624-94696646 CTTTTTGGAGGTGAGAGCTGGGG + Intergenic
1058055495 9:100444524-100444546 GGTTGTGGAGGAGTGTGCTGGGG + Intronic
1058870045 9:109193472-109193494 GGTTTTGGAAGTGAGTGCTGTGG + Intronic
1058978799 9:110150026-110150048 GTGTTTGGAGGTGGGCCCTTTGG + Intronic
1059556686 9:115287972-115287994 GTGTTTGGAGGTGAGGCCTTTGG + Intronic
1060400566 9:123346437-123346459 GTGTTTGTAGATGTGTACTGAGG + Intergenic
1061454633 9:130688481-130688503 GTGTTTGTGGGTGTGGGCTCTGG + Intergenic
1061578491 9:131522608-131522630 GTGTTTGGAGGTTGGAGCAGAGG + Intronic
1061920271 9:133778749-133778771 GTGGTGGGAGGTGGGTCCTGGGG - Exonic
1061993525 9:134172867-134172889 GTGTTAGTGGGTGTGGGCTGGGG + Intergenic
1062325558 9:136010915-136010937 GTGTGTGCAGGGGTGTGGTGAGG - Exonic
1062430167 9:136523396-136523418 GTGTCTGGAGGTGTCAGCTCTGG - Intronic
1062479647 9:136745395-136745417 GTGCTTGGAGGGGTCTCCTGGGG - Intronic
1203783138 EBV:112279-112301 GTGTTTTGAGGTGTTTGATGGGG - Intergenic
1203564563 Un_KI270744v1:80417-80439 ATGTTGGGGGGTGTGAGCTGGGG - Intergenic
1186000106 X:5000109-5000131 GTGTTAGGAGGTGTGGCCTTTGG - Intergenic
1186445181 X:9621084-9621106 GTGGGTGGAGGTCTCTGCTGTGG + Intronic
1186680027 X:11862930-11862952 CTGATTGGAGGTGTGTGGTTAGG + Intergenic
1187308922 X:18122241-18122263 GTGTGTGTATGTGTGTGTTGAGG - Intergenic
1187683968 X:21798038-21798060 GTGGTTAGGGGTGTGGGCTGGGG + Intergenic
1188178541 X:27024493-27024515 GTATTTGGAGGTGTGGTCTTTGG - Intergenic
1188231791 X:27673042-27673064 GTGTGTGTATGTGTGTGGTGGGG - Intronic
1189176721 X:38964729-38964751 GAGTTTGCAGCTCTGTGCTGTGG - Intergenic
1190375997 X:49788902-49788924 TTGTTTGGAGGTTGGTGCTCAGG + Intergenic
1190376328 X:49791943-49791965 GTGTTTGGAGGTCTGTGTTCAGG + Intergenic
1190376422 X:49792895-49792917 GTATTTGGAGGTCTGTGTTAAGG + Intergenic
1190742866 X:53301629-53301651 GGGCTTGGAGGTGTTGGCTGGGG + Intronic
1193082822 X:77422613-77422635 GAGTTTGCAGGTGTGGGCAGAGG - Intergenic
1193876970 X:86872840-86872862 GTTGTTGGGGGTGTGTCCTGAGG - Intergenic
1194598695 X:95892557-95892579 GTGTGTGTATGTGTGTGTTGGGG + Intergenic
1196550290 X:117016523-117016545 TTGTTTGGATGTCTGTGGTGAGG + Intergenic
1196660017 X:118259808-118259830 ATGTTTGAAGATGAGTGCTGAGG - Intergenic
1197823743 X:130567196-130567218 GTGTGTGGGGGTGTGAGGTGAGG + Intergenic
1198482024 X:137050261-137050283 GAGTATGGAGCTGTGTGCAGTGG - Intergenic
1199609078 X:149598514-149598536 GTTTCTGGAGGTCTGGGCTGGGG - Intronic
1199630041 X:149770843-149770865 GTTTCTGGAGGTCTGGGCTGGGG + Intergenic
1200791667 Y:7304880-7304902 GTGTTAGGTGGTGTGTCCTTTGG - Intergenic
1201158867 Y:11154078-11154100 GTGTTGGGGGGTGTGAGCTGGGG + Intergenic
1201400288 Y:13597454-13597476 GTTGTTGAAGGTGGGTGCTGAGG + Intergenic
1201745915 Y:17373318-17373340 GTGTTTGTGTGTGTGTGCAGAGG - Intergenic
1202387053 Y:24336273-24336295 GTGTTTGTATGTGTGTGTAGAGG - Intergenic
1202483733 Y:25333855-25333877 GTGTTTGTATGTGTGTGTAGAGG + Intergenic