ID: 934051117

View in Genome Browser
Species Human (GRCh38)
Location 2:88211845-88211867
Sequence CTGTCTCTCCAGATGCAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934051117_934051121 3 Left 934051117 2:88211845-88211867 CCCAATTGCATCTGGAGAGACAG No data
Right 934051121 2:88211871-88211893 CACATGCATCAGAGTATGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934051117 Original CRISPR CTGTCTCTCCAGATGCAATT GGG (reversed) Intergenic
No off target data available for this crispr