ID: 934067052

View in Genome Browser
Species Human (GRCh38)
Location 2:88350404-88350426
Sequence TCCTGAAGGGATTTCAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934067052_934067058 23 Left 934067052 2:88350404-88350426 CCCGACCTGAAATCCCTTCAGGA No data
Right 934067058 2:88350450-88350472 CCCGAAAGCTTTGCTTCCAGTGG No data
934067052_934067062 30 Left 934067052 2:88350404-88350426 CCCGACCTGAAATCCCTTCAGGA No data
Right 934067062 2:88350457-88350479 GCTTTGCTTCCAGTGGGTCTGGG No data
934067052_934067060 24 Left 934067052 2:88350404-88350426 CCCGACCTGAAATCCCTTCAGGA No data
Right 934067060 2:88350451-88350473 CCGAAAGCTTTGCTTCCAGTGGG No data
934067052_934067061 29 Left 934067052 2:88350404-88350426 CCCGACCTGAAATCCCTTCAGGA No data
Right 934067061 2:88350456-88350478 AGCTTTGCTTCCAGTGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934067052 Original CRISPR TCCTGAAGGGATTTCAGGTC GGG (reversed) Intergenic