ID: 934067123

View in Genome Browser
Species Human (GRCh38)
Location 2:88350651-88350673
Sequence TCTGCTCTGTGGTCTCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934067123_934067131 8 Left 934067123 2:88350651-88350673 CCCCCAGGAGACCACAGAGCAGA No data
Right 934067131 2:88350682-88350704 AAAGGAGCCTTCTCAGGTACAGG No data
934067123_934067129 -10 Left 934067123 2:88350651-88350673 CCCCCAGGAGACCACAGAGCAGA No data
Right 934067129 2:88350664-88350686 ACAGAGCAGAAGGAATTCAAAGG No data
934067123_934067130 2 Left 934067123 2:88350651-88350673 CCCCCAGGAGACCACAGAGCAGA No data
Right 934067130 2:88350676-88350698 GAATTCAAAGGAGCCTTCTCAGG No data
934067123_934067133 23 Left 934067123 2:88350651-88350673 CCCCCAGGAGACCACAGAGCAGA No data
Right 934067133 2:88350697-88350719 GGTACAGGTGTGTGCATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934067123 Original CRISPR TCTGCTCTGTGGTCTCCTGG GGG (reversed) Intergenic
No off target data available for this crispr