ID: 934067127

View in Genome Browser
Species Human (GRCh38)
Location 2:88350654-88350676
Sequence CCAGGAGACCACAGAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934067112_934067127 27 Left 934067112 2:88350604-88350626 CCCGAGGGCACAGGCTGCCAAAC No data
Right 934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG No data
934067117_934067127 2 Left 934067117 2:88350629-88350651 CCACCCACTGCCGCCGGCGAAGC No data
Right 934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG No data
934067119_934067127 -2 Left 934067119 2:88350633-88350655 CCACTGCCGCCGGCGAAGCCCCC No data
Right 934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG No data
934067111_934067127 30 Left 934067111 2:88350601-88350623 CCTCCCGAGGGCACAGGCTGCCA No data
Right 934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG No data
934067121_934067127 -8 Left 934067121 2:88350639-88350661 CCGCCGGCGAAGCCCCCAGGAGA No data
Right 934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG No data
934067113_934067127 26 Left 934067113 2:88350605-88350627 CCGAGGGCACAGGCTGCCAAACT No data
Right 934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG No data
934067116_934067127 3 Left 934067116 2:88350628-88350650 CCCACCCACTGCCGCCGGCGAAG No data
Right 934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG No data
934067114_934067127 10 Left 934067114 2:88350621-88350643 CCAAACTCCCACCCACTGCCGCC No data
Right 934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG No data
934067118_934067127 -1 Left 934067118 2:88350632-88350654 CCCACTGCCGCCGGCGAAGCCCC No data
Right 934067127 2:88350654-88350676 CCAGGAGACCACAGAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934067127 Original CRISPR CCAGGAGACCACAGAGCAGA AGG Intergenic
No off target data available for this crispr