ID: 934068752

View in Genome Browser
Species Human (GRCh38)
Location 2:88364479-88364501
Sequence TTAAAAAAGAAGAGGATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934068750_934068752 11 Left 934068750 2:88364445-88364467 CCTTTCATCTAGACTCAGAAGCT No data
Right 934068752 2:88364479-88364501 TTAAAAAAGAAGAGGATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934068752 Original CRISPR TTAAAAAAGAAGAGGATCCA AGG Intergenic
No off target data available for this crispr