ID: 934068796

View in Genome Browser
Species Human (GRCh38)
Location 2:88364744-88364766
Sequence CCTGGCCCTCAGCTGAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 283}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934068796_934068804 11 Left 934068796 2:88364744-88364766 CCTGGTTTCAGCTGAGGGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 283
Right 934068804 2:88364778-88364800 TCTTAAGGATGGTGCTTAGCGGG 0: 1
1: 0
2: 1
3: 8
4: 88
934068796_934068806 21 Left 934068796 2:88364744-88364766 CCTGGTTTCAGCTGAGGGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 283
Right 934068806 2:88364788-88364810 GGTGCTTAGCGGGTGCCCATGGG 0: 1
1: 2
2: 1
3: 5
4: 62
934068796_934068803 10 Left 934068796 2:88364744-88364766 CCTGGTTTCAGCTGAGGGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 283
Right 934068803 2:88364777-88364799 ATCTTAAGGATGGTGCTTAGCGG 0: 1
1: 0
2: 0
3: 7
4: 102
934068796_934068801 0 Left 934068796 2:88364744-88364766 CCTGGTTTCAGCTGAGGGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 283
Right 934068801 2:88364767-88364789 GATCATAACCATCTTAAGGATGG 0: 1
1: 0
2: 0
3: 7
4: 90
934068796_934068805 20 Left 934068796 2:88364744-88364766 CCTGGTTTCAGCTGAGGGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 283
Right 934068805 2:88364787-88364809 TGGTGCTTAGCGGGTGCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 107
934068796_934068808 23 Left 934068796 2:88364744-88364766 CCTGGTTTCAGCTGAGGGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 283
Right 934068808 2:88364790-88364812 TGCTTAGCGGGTGCCCATGGGGG 0: 1
1: 1
2: 0
3: 9
4: 79
934068796_934068807 22 Left 934068796 2:88364744-88364766 CCTGGTTTCAGCTGAGGGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 283
Right 934068807 2:88364789-88364811 GTGCTTAGCGGGTGCCCATGGGG 0: 1
1: 0
2: 3
3: 3
4: 73
934068796_934068800 -4 Left 934068796 2:88364744-88364766 CCTGGTTTCAGCTGAGGGCCAGG 0: 1
1: 0
2: 1
3: 30
4: 283
Right 934068800 2:88364763-88364785 CAGGGATCATAACCATCTTAAGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934068796 Original CRISPR CCTGGCCCTCAGCTGAAACC AGG (reversed) Intergenic