ID: 934076245

View in Genome Browser
Species Human (GRCh38)
Location 2:88430977-88430999
Sequence GTGTTGTTACAGATAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934076245_934076246 -3 Left 934076245 2:88430977-88430999 CCTTGTTCTATCTGTAACAACAC No data
Right 934076246 2:88430997-88431019 CACTCTGAATATTTCCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934076245 Original CRISPR GTGTTGTTACAGATAGAACA AGG (reversed) Intergenic
No off target data available for this crispr