ID: 934078964

View in Genome Browser
Species Human (GRCh38)
Location 2:88451895-88451917
Sequence CCCCGCGACGAGGACGACCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 3, 1: 0, 2: 0, 3: 1, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934078964_934078970 17 Left 934078964 2:88451895-88451917 CCTGGGTCGTCCTCGTCGCGGGG 0: 3
1: 0
2: 0
3: 1
4: 33
Right 934078970 2:88451935-88451957 CGTTGAGCGACAGGTTGTGGCGG 0: 3
1: 5
2: 9
3: 8
4: 41
934078964_934078971 21 Left 934078964 2:88451895-88451917 CCTGGGTCGTCCTCGTCGCGGGG 0: 3
1: 0
2: 0
3: 1
4: 33
Right 934078971 2:88451939-88451961 GAGCGACAGGTTGTGGCGGATGG 0: 3
1: 1
2: 4
3: 10
4: 82
934078964_934078968 8 Left 934078964 2:88451895-88451917 CCTGGGTCGTCCTCGTCGCGGGG 0: 3
1: 0
2: 0
3: 1
4: 33
Right 934078968 2:88451926-88451948 TGAAGCAGTCGTTGAGCGACAGG 0: 3
1: 0
2: 4
3: 14
4: 43
934078964_934078969 14 Left 934078964 2:88451895-88451917 CCTGGGTCGTCCTCGTCGCGGGG 0: 3
1: 0
2: 0
3: 1
4: 33
Right 934078969 2:88451932-88451954 AGTCGTTGAGCGACAGGTTGTGG 0: 3
1: 3
2: 12
3: 7
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934078964 Original CRISPR CCCCGCGACGAGGACGACCC AGG (reversed) Exonic
900100383 1:959916-959938 CCCCGCGACAAGGGCGCCGCGGG + Intergenic
1076096482 10:127737763-127737785 CCCCGCGACGAGGACGACCCAGG + Exonic
1083172013 11:60928755-60928777 TCCGGCGAGGAGAACGACCCTGG + Exonic
1088906929 11:114162152-114162174 CCCTGCCAGGAGGATGACCCAGG - Intronic
1097894223 12:64808335-64808357 CCACGTGGCCAGGACGACCCTGG - Intronic
1115028535 14:28768006-28768028 CCGCGCCACTACGACGACCCGGG + Exonic
1132879467 16:2155645-2155667 CCCCGCGACGACGAGGCCGCCGG + Intergenic
1132879527 16:2155867-2155889 CCCCGCGGCGCGCCCGACCCGGG + Intronic
1141429762 16:83965519-83965541 CGCCGGGCCGTGGACGACCCTGG + Exonic
1142715913 17:1746918-1746940 ACCCGTGACGAGGACGTCCACGG - Intronic
1149347278 17:55751287-55751309 CCCTGCGGGGAGGTCGACCCCGG - Intronic
1150320919 17:64213790-64213812 GGCCCCGACGAAGACGACCCTGG + Exonic
1161587015 19:5111111-5111133 CCCCGCCAGGAGGCTGACCCTGG + Intronic
1161672567 19:5622408-5622430 CCCCGCGTCTTGGCCGACCCCGG - Intronic
1168536159 19:57172233-57172255 CGCCGCGGAGAGGACGAGCCCGG - Intergenic
927699986 2:25261858-25261880 CCCCTCCATGAGGACCACCCTGG + Intronic
934078964 2:88451895-88451917 CCCCGCGACGAGGACGACCCAGG - Exonic
938302830 2:130228666-130228688 CCCCGCGACAGGGTCGCCCCGGG - Intergenic
938453839 2:131445556-131445578 CCCCGCGACAGGGTCGCCCCGGG + Intergenic
946422023 2:219570667-219570689 GGCCGCGCCGAGGACGGCCCCGG - Exonic
1176267926 20:64220461-64220483 CCCCGAGACCAGGACCAACCTGG + Intronic
1176284858 21:5014017-5014039 CCCCGCGATGAGGATGAGCAAGG - Intergenic
1179872323 21:44249458-44249480 CCCCGCGATGAGGATGAGCAAGG + Intronic
1179934563 21:44593820-44593842 CCCCGCGATGAGGATGAGCAAGG + Intronic
1180177924 21:46099007-46099029 GCCCGCGCCTAGGACGCCCCTGG + Intronic
1185085972 22:48741233-48741255 CCCAGCGGTGAGGACGACTCCGG - Intronic
953766399 3:45746800-45746822 CCCCGCTATGAGGCAGACCCTGG - Intergenic
990753227 5:59039893-59039915 CCCCGCGGCGGGCGCGACCCCGG - Intronic
997584171 5:135034751-135034773 CCCCTCGACGAGGACACCGCTGG - Intronic
1001246087 5:170106510-170106532 CCCCGCGACGAGGACGACCCGGG + Exonic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1021163098 7:17299339-17299361 CCCCGCGATGAGGACGCGCTCGG - Intronic
1041464545 8:58145743-58145765 CCGCGCGAGGGGGACGACCCGGG - Intronic
1061885044 9:133587211-133587233 ACCGGCGACCAGGGCGACCCAGG + Intergenic
1062384500 9:136303818-136303840 CCCCGCGGCCATGCCGACCCTGG - Exonic
1185877952 X:3714773-3714795 ACCCGCGACCAGGGCGGCCCAGG + Intergenic
1200163336 X:154020013-154020035 CCCCGCGCCGGGGAGGGCCCGGG + Intergenic