ID: 934079776

View in Genome Browser
Species Human (GRCh38)
Location 2:88458086-88458108
Sequence GCAGCCCTTTCCCCCCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934079774_934079776 5 Left 934079774 2:88458058-88458080 CCGAGTCTAGTGTTCGTGGGAAA No data
Right 934079776 2:88458086-88458108 GCAGCCCTTTCCCCCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934079776 Original CRISPR GCAGCCCTTTCCCCCCATGA AGG Intergenic
No off target data available for this crispr