ID: 934085302

View in Genome Browser
Species Human (GRCh38)
Location 2:88504378-88504400
Sequence GTCCGGAATCGGTAGCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934085302_934085314 25 Left 934085302 2:88504378-88504400 CCAAGAAGCTACCGATTCCGGAC No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data
934085302_934085306 -4 Left 934085302 2:88504378-88504400 CCAAGAAGCTACCGATTCCGGAC No data
Right 934085306 2:88504397-88504419 GGACCCACCAACACTTGGAGAGG No data
934085302_934085309 2 Left 934085302 2:88504378-88504400 CCAAGAAGCTACCGATTCCGGAC No data
Right 934085309 2:88504403-88504425 ACCAACACTTGGAGAGGCCAAGG No data
934085302_934085304 -9 Left 934085302 2:88504378-88504400 CCAAGAAGCTACCGATTCCGGAC No data
Right 934085304 2:88504392-88504414 ATTCCGGACCCACCAACACTTGG No data
934085302_934085312 9 Left 934085302 2:88504378-88504400 CCAAGAAGCTACCGATTCCGGAC No data
Right 934085312 2:88504410-88504432 CTTGGAGAGGCCAAGGCAGGAGG No data
934085302_934085311 6 Left 934085302 2:88504378-88504400 CCAAGAAGCTACCGATTCCGGAC No data
Right 934085311 2:88504407-88504429 ACACTTGGAGAGGCCAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934085302 Original CRISPR GTCCGGAATCGGTAGCTTCT TGG (reversed) Intergenic