ID: 934085303

View in Genome Browser
Species Human (GRCh38)
Location 2:88504389-88504411
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934085303_934085314 14 Left 934085303 2:88504389-88504411 CCGATTCCGGACCCACCAACACT No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data
934085303_934085311 -5 Left 934085303 2:88504389-88504411 CCGATTCCGGACCCACCAACACT No data
Right 934085311 2:88504407-88504429 ACACTTGGAGAGGCCAAGGCAGG No data
934085303_934085309 -9 Left 934085303 2:88504389-88504411 CCGATTCCGGACCCACCAACACT No data
Right 934085309 2:88504403-88504425 ACCAACACTTGGAGAGGCCAAGG No data
934085303_934085312 -2 Left 934085303 2:88504389-88504411 CCGATTCCGGACCCACCAACACT No data
Right 934085312 2:88504410-88504432 CTTGGAGAGGCCAAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934085303 Original CRISPR AGTGTTGGTGGGTCCGGAAT CGG (reversed) Intergenic