ID: 934085305

View in Genome Browser
Species Human (GRCh38)
Location 2:88504395-88504417
Sequence TCTCCAAGTGTTGGTGGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934085305_934085314 8 Left 934085305 2:88504395-88504417 CCGGACCCACCAACACTTGGAGA No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data
934085305_934085318 26 Left 934085305 2:88504395-88504417 CCGGACCCACCAACACTTGGAGA No data
Right 934085318 2:88504444-88504466 CCTGGAGTTTGAGACCAGCTGGG No data
934085305_934085312 -8 Left 934085305 2:88504395-88504417 CCGGACCCACCAACACTTGGAGA No data
Right 934085312 2:88504410-88504432 CTTGGAGAGGCCAAGGCAGGAGG No data
934085305_934085316 25 Left 934085305 2:88504395-88504417 CCGGACCCACCAACACTTGGAGA No data
Right 934085316 2:88504443-88504465 CCCTGGAGTTTGAGACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934085305 Original CRISPR TCTCCAAGTGTTGGTGGGTC CGG (reversed) Intergenic