ID: 934085308

View in Genome Browser
Species Human (GRCh38)
Location 2:88504401-88504423
Sequence TTGGCCTCTCCAAGTGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934085308_934085316 19 Left 934085308 2:88504401-88504423 CCACCAACACTTGGAGAGGCCAA No data
Right 934085316 2:88504443-88504465 CCCTGGAGTTTGAGACCAGCTGG No data
934085308_934085314 2 Left 934085308 2:88504401-88504423 CCACCAACACTTGGAGAGGCCAA No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data
934085308_934085319 28 Left 934085308 2:88504401-88504423 CCACCAACACTTGGAGAGGCCAA No data
Right 934085319 2:88504452-88504474 TTGAGACCAGCTGGGCTACATGG No data
934085308_934085318 20 Left 934085308 2:88504401-88504423 CCACCAACACTTGGAGAGGCCAA No data
Right 934085318 2:88504444-88504466 CCTGGAGTTTGAGACCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934085308 Original CRISPR TTGGCCTCTCCAAGTGTTGG TGG (reversed) Intergenic