ID: 934085309

View in Genome Browser
Species Human (GRCh38)
Location 2:88504403-88504425
Sequence ACCAACACTTGGAGAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934085302_934085309 2 Left 934085302 2:88504378-88504400 CCAAGAAGCTACCGATTCCGGAC No data
Right 934085309 2:88504403-88504425 ACCAACACTTGGAGAGGCCAAGG No data
934085303_934085309 -9 Left 934085303 2:88504389-88504411 CCGATTCCGGACCCACCAACACT No data
Right 934085309 2:88504403-88504425 ACCAACACTTGGAGAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934085309 Original CRISPR ACCAACACTTGGAGAGGCCA AGG Intergenic