ID: 934085310

View in Genome Browser
Species Human (GRCh38)
Location 2:88504404-88504426
Sequence GCCTTGGCCTCTCCAAGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934085310_934085314 -1 Left 934085310 2:88504404-88504426 CCAACACTTGGAGAGGCCAAGGC No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data
934085310_934085319 25 Left 934085310 2:88504404-88504426 CCAACACTTGGAGAGGCCAAGGC No data
Right 934085319 2:88504452-88504474 TTGAGACCAGCTGGGCTACATGG No data
934085310_934085318 17 Left 934085310 2:88504404-88504426 CCAACACTTGGAGAGGCCAAGGC No data
Right 934085318 2:88504444-88504466 CCTGGAGTTTGAGACCAGCTGGG No data
934085310_934085316 16 Left 934085310 2:88504404-88504426 CCAACACTTGGAGAGGCCAAGGC No data
Right 934085316 2:88504443-88504465 CCCTGGAGTTTGAGACCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934085310 Original CRISPR GCCTTGGCCTCTCCAAGTGT TGG (reversed) Intergenic