ID: 934085311

View in Genome Browser
Species Human (GRCh38)
Location 2:88504407-88504429
Sequence ACACTTGGAGAGGCCAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934085302_934085311 6 Left 934085302 2:88504378-88504400 CCAAGAAGCTACCGATTCCGGAC No data
Right 934085311 2:88504407-88504429 ACACTTGGAGAGGCCAAGGCAGG No data
934085303_934085311 -5 Left 934085303 2:88504389-88504411 CCGATTCCGGACCCACCAACACT No data
Right 934085311 2:88504407-88504429 ACACTTGGAGAGGCCAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934085311 Original CRISPR ACACTTGGAGAGGCCAAGGC AGG Intergenic