ID: 934085312

View in Genome Browser
Species Human (GRCh38)
Location 2:88504410-88504432
Sequence CTTGGAGAGGCCAAGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934085303_934085312 -2 Left 934085303 2:88504389-88504411 CCGATTCCGGACCCACCAACACT No data
Right 934085312 2:88504410-88504432 CTTGGAGAGGCCAAGGCAGGAGG No data
934085305_934085312 -8 Left 934085305 2:88504395-88504417 CCGGACCCACCAACACTTGGAGA No data
Right 934085312 2:88504410-88504432 CTTGGAGAGGCCAAGGCAGGAGG No data
934085302_934085312 9 Left 934085302 2:88504378-88504400 CCAAGAAGCTACCGATTCCGGAC No data
Right 934085312 2:88504410-88504432 CTTGGAGAGGCCAAGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934085312 Original CRISPR CTTGGAGAGGCCAAGGCAGG AGG Intergenic