ID: 934085314

View in Genome Browser
Species Human (GRCh38)
Location 2:88504426-88504448
Sequence CAGGAGGATTGCTTGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934085305_934085314 8 Left 934085305 2:88504395-88504417 CCGGACCCACCAACACTTGGAGA No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data
934085310_934085314 -1 Left 934085310 2:88504404-88504426 CCAACACTTGGAGAGGCCAAGGC No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data
934085303_934085314 14 Left 934085303 2:88504389-88504411 CCGATTCCGGACCCACCAACACT No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data
934085302_934085314 25 Left 934085302 2:88504378-88504400 CCAAGAAGCTACCGATTCCGGAC No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data
934085308_934085314 2 Left 934085308 2:88504401-88504423 CCACCAACACTTGGAGAGGCCAA No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data
934085307_934085314 3 Left 934085307 2:88504400-88504422 CCCACCAACACTTGGAGAGGCCA No data
Right 934085314 2:88504426-88504448 CAGGAGGATTGCTTGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934085314 Original CRISPR CAGGAGGATTGCTTGAGCCC TGG Intergenic