ID: 934095551

View in Genome Browser
Species Human (GRCh38)
Location 2:88599754-88599776
Sequence CTACTGCTTTAGAGGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934095551_934095556 -10 Left 934095551 2:88599754-88599776 CCTCTTTTCCTCTAAAGCAGTAG 0: 1
1: 0
2: 1
3: 20
4: 232
Right 934095556 2:88599767-88599789 AAAGCAGTAGCGGGTCCTTAGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934095551 Original CRISPR CTACTGCTTTAGAGGAAAAG AGG (reversed) Intronic
903260098 1:22127003-22127025 CCACTGACTAAGAGGAAAAGGGG - Intronic
907620049 1:55968352-55968374 CTAGGGTTGTAGAGGAAAAGGGG - Intergenic
909132891 1:71761261-71761283 CTACTGCTGTAGAGTTAAAGCGG + Intronic
909909267 1:81241655-81241677 CTCCTGCTTTGCAGGAAAATTGG + Intergenic
910973749 1:92883977-92883999 CTTCTGCCTTAGAGGAGAACTGG + Intronic
911123743 1:94321104-94321126 CTACTGCTATTGAGGCAAACAGG - Intergenic
915812763 1:158932295-158932317 GGACTGCTTGAGAGGAAAGGTGG + Intronic
916040579 1:160957848-160957870 CCAATGCTTTGGAGGAAAAAAGG + Intergenic
916344344 1:163771185-163771207 GTCCTGCTTCAGAGAAAAAGGGG + Intergenic
917191365 1:172422584-172422606 CTTCTGCTTGAGAAGAACAGAGG + Intronic
919963453 1:202496148-202496170 TTACTGTTTTAGAGAAAAAGTGG + Intronic
921126426 1:212182052-212182074 AGACTCCTTTAGAGGAAAATGGG + Intergenic
921583007 1:216916618-216916640 TTTGTACTTTAGAGGAAAAGAGG - Intronic
921962353 1:221048522-221048544 GTGATCCTTTAGAGGAAAAGAGG - Intergenic
922234215 1:223711266-223711288 CTACTACTGTAGAGAAGAAGAGG + Intronic
923260240 1:232261385-232261407 CTGGTGCTTTTGAGGAAAACTGG - Intergenic
924031999 1:239895132-239895154 CTACTGCTGCAGAGAAAAAGAGG - Intronic
1063327456 10:5118599-5118621 TAACTAGTTTAGAGGAAAAGAGG + Intronic
1064146711 10:12831768-12831790 CTATTGCTTCAGAGAAAGAGAGG + Exonic
1065893694 10:30142554-30142576 CCACTACTCTAGATGAAAAGGGG + Intergenic
1066084506 10:31963208-31963230 CTTCTGCTTTAGAGAAGCAGAGG + Intergenic
1067261394 10:44696014-44696036 CTACTGGTTTGGAGGTAAACAGG - Intergenic
1068386041 10:56328906-56328928 CTGCAACTTAAGAGGAAAAGTGG + Intergenic
1068972256 10:62972231-62972253 CAAATGCTTTAAGGGAAAAGTGG - Intergenic
1069720316 10:70545407-70545429 GTACTGCTGTGGAGGCAAAGGGG + Intronic
1072440658 10:95451709-95451731 CGACTGCTTCAGAAGAAAAATGG - Intronic
1074930145 10:118116827-118116849 ATAATGATTTAGAGGAAAGGAGG - Intergenic
1076063742 10:127432168-127432190 CAACTGCTTTACAGAAAATGTGG + Intronic
1077805130 11:5582845-5582867 ATAGTGATTTAGATGAAAAGTGG - Intronic
1077848172 11:6047839-6047861 CTACTTGTATAGAAGAAAAGAGG + Intergenic
1078055010 11:8002198-8002220 CTACTTCTGGAGAGTAAAAGAGG + Intergenic
1078605604 11:12772405-12772427 ATTCTGCATCAGAGGAAAAGAGG - Intronic
1082780734 11:57285653-57285675 CTTTTGCTTTAGAGGGAAATGGG + Intergenic
1083968008 11:66054729-66054751 CCACTGCTTTAGAGAAAATGAGG - Intronic
1085063149 11:73467210-73467232 GTACTCCTCTAGAGGAAAGGAGG - Intronic
1087971193 11:104487000-104487022 CTTTTGCATTAGAGGAAAGGAGG - Intergenic
1088256227 11:107905850-107905872 CAAAAGCTTTAGAGGACAAGAGG + Intronic
1088354837 11:108932056-108932078 CTAGCCCTTTAGAGGAAAAAGGG - Intronic
1089091588 11:115881787-115881809 CTAATGCTTTAGATGAACTGGGG + Intergenic
1091958887 12:4673304-4673326 GTAATCCTTTGGAGGAAAAGAGG - Intronic
1092283105 12:7112247-7112269 CTGCTGGTATAGAGGACAAGGGG + Intergenic
1093738156 12:22648376-22648398 CCACTGGTTAAGGGGAAAAGAGG - Intronic
1094449679 12:30571605-30571627 CTACTGCCTAAGAGGACAATGGG + Intergenic
1095375230 12:41519483-41519505 CTACTGCTTCAGAGGAATTGGGG - Intronic
1095852961 12:46831015-46831037 CTGCTGACTTGGAGGAAAAGGGG - Intronic
1096098509 12:48954374-48954396 GGGCTGCCTTAGAGGAAAAGAGG - Intronic
1096269034 12:50149025-50149047 CTACTGTTTTAGAAAAAAAATGG - Intronic
1096464701 12:51841868-51841890 TTGCTTCTTTTGAGGAAAAGGGG - Intergenic
1099508930 12:83509634-83509656 CTGTTGACTTAGAGGAAAAGAGG - Intergenic
1099540296 12:83899863-83899885 GTAATCCTTTAGAGGAGAAGAGG - Intergenic
1100904854 12:99286151-99286173 CTTCTGCTTGAGAAGAAGAGAGG + Intronic
1102678784 12:114676125-114676147 CTACTGCCTTAGCGGGGAAGGGG + Intronic
1102775702 12:115516801-115516823 CTTCTTCTTTAGAGGATATGAGG - Intergenic
1104389775 12:128381872-128381894 CAACCTCTTAAGAGGAAAAGGGG + Intronic
1105906047 13:24811691-24811713 CTACTCCTTTGGAGGAGGAGAGG + Intronic
1108061027 13:46533580-46533602 GGACTGCTTTATAAGAAAAGAGG - Intergenic
1108283599 13:48883645-48883667 ATATTGCAATAGAGGAAAAGAGG - Intergenic
1110673764 13:78213688-78213710 CTGCTGCTTAAGAGGATTAGAGG + Intergenic
1112537148 13:100270572-100270594 CTACTTATTTAGAGAAAAAAAGG + Intronic
1112917668 13:104571402-104571424 AAACTGCTTTTGAGGAAGAGAGG - Intergenic
1113329442 13:109314390-109314412 TTTATGCTTTAGAGGAAAATAGG + Intergenic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1113876068 13:113595492-113595514 CTGGTGCTTTACAGGAAAGGCGG + Intronic
1114674916 14:24433302-24433324 ATACTGGTTTAGTGGAAAGGTGG + Intronic
1115518485 14:34209085-34209107 CTCCTGTTTAAGAGGAAAGGAGG + Intronic
1117566681 14:57000724-57000746 CTCCAGCTTTAGAGGAGCAGTGG - Intergenic
1119214221 14:72856284-72856306 CTCCTGTTTTAGAGGAGAAAAGG - Intronic
1119865980 14:77974859-77974881 CTACTGCTGCAGTGGAAAAAGGG + Intergenic
1120982716 14:90304929-90304951 TTTCTACTCTAGAGGAAAAGAGG + Intronic
1121787227 14:96671208-96671230 CTGCAGCTTTGGAGGGAAAGGGG - Intergenic
1122758848 14:104005185-104005207 CCAGTGCTTCAGAGGGAAAGAGG - Intronic
1124349819 15:28947082-28947104 CTCCTGCTCTCCAGGAAAAGAGG - Intronic
1124653390 15:31488769-31488791 GTGTTGCTTAAGAGGAAAAGTGG + Intronic
1127249896 15:57222440-57222462 CTACTGCTTAAAAAGAGAAGGGG + Intronic
1127638980 15:60897420-60897442 CTTCTCCTGTAGAGGAAGAGGGG + Intronic
1128612177 15:69083098-69083120 CTACTGCTTCAGGAGAGAAGAGG - Intergenic
1131603110 15:93870339-93870361 CTCCTACTTTAGATTAAAAGTGG + Intergenic
1133126542 16:3651068-3651090 CTACTGATCAAGAGGGAAAGCGG - Intronic
1134232529 16:12439794-12439816 CTACTGCCCTAGCAGAAAAGTGG - Intronic
1134805026 16:17117057-17117079 CTTCTGCTTTAGAGCTACAGTGG - Intronic
1137315553 16:47317529-47317551 CCACTGCTTTAGAGAAATTGTGG - Intronic
1141451958 16:84109958-84109980 CAAATGCTTTAGAGAAAAAATGG + Intronic
1143313467 17:6013209-6013231 TTTTTGCTTTCGAGGAAAAGGGG - Intronic
1144188857 17:12824600-12824622 CTACTGTGTTAGAAGCAAAGTGG - Intronic
1144439299 17:15267009-15267031 CTAAAGATTCAGAGGAAAAGGGG + Intergenic
1145234206 17:21197381-21197403 CCCCTGCCTTAGAGGAAATGTGG + Exonic
1146376045 17:32295292-32295314 CACCTGCTTTAGAGGCTAAGGGG - Intronic
1146742963 17:35302238-35302260 CTAATCCTTTGGAGGAGAAGAGG - Intergenic
1147981228 17:44275417-44275439 CTCGTGCTTTCGAGGAACAGAGG - Intergenic
1148943721 17:51239544-51239566 CTTCTGATTTAGAGGTAAAAGGG - Intronic
1150226367 17:63526742-63526764 TTACCCCTTTAGAGGAAAAGAGG - Intronic
1153355595 18:4131606-4131628 CTCCTGCTTTAGAGGACTAGAGG + Intronic
1155089279 18:22490450-22490472 AGACCACTTTAGAGGAAAAGTGG + Intergenic
1156188985 18:34696879-34696901 CCACTGCTTTAGAGTAAAGTGGG - Intronic
1157089122 18:44614452-44614474 AAACTGCTTCAGAGGAAAACTGG - Intergenic
1157353818 18:46915546-46915568 CAGCTGATTTACAGGAAAAGAGG + Intronic
1158236536 18:55322169-55322191 CAACTGCCTTAGGGTAAAAGTGG + Intronic
1158285265 18:55873847-55873869 CCACTGCTTTAAAGGATAGGCGG - Intergenic
1158688698 18:59640661-59640683 CAACTTCTATAGAGCAAAAGCGG + Intronic
1164132412 19:22377029-22377051 TTACTCTTTTTGAGGAAAAGTGG - Intergenic
1166690579 19:44819667-44819689 CTACTGCGTGAGACGCAAAGGGG + Exonic
925279786 2:2675555-2675577 CTACGGCTTTAGAGGTACAGAGG - Intergenic
925400296 2:3568010-3568032 TTACTGCCATACAGGAAAAGTGG + Intergenic
925908029 2:8551209-8551231 TCACTGCTTTAGAGGAATTGGGG - Intergenic
926682238 2:15672799-15672821 CTGCTGCTTCACAGGTAAAGTGG + Intergenic
927122756 2:19983723-19983745 CTAGTGATTTAGAGGAAATTAGG - Intronic
929203720 2:39266202-39266224 CAGCTGGTTTAGAGCAAAAGAGG - Intronic
931415351 2:62075302-62075324 TTACTGCTATAGAGGAACACAGG - Intronic
931836173 2:66100265-66100287 CCACTGCTCTAGATTAAAAGAGG - Intergenic
933222119 2:79702476-79702498 CTCCTGCTGTAGAGGATGAGAGG + Intronic
933446578 2:82387425-82387447 CTTCTGCTTAAGAGGAGGAGAGG + Intergenic
933758497 2:85659329-85659351 CCACTGCTTTACAGGACAGGGGG - Intronic
934095551 2:88599754-88599776 CTACTGCTTTAGAGGAAAAGAGG - Intronic
934667259 2:96181158-96181180 CTACTGTTCTAGATGAAAAGTGG + Intergenic
934818752 2:97353769-97353791 TTACTGCTAAAGAGTAAAAGAGG + Intergenic
934899497 2:98146728-98146750 CTCCTAGTTTAGAGGAAAAAAGG + Intronic
935010822 2:99134635-99134657 GTAATCCTTTAGAGGAGAAGAGG + Intronic
937359980 2:121222822-121222844 TTCCTTCTTTAGAGGAGAAGCGG - Exonic
937807412 2:126161860-126161882 GTGATGCTTTGGAGGAAAAGAGG - Intergenic
939260351 2:139800376-139800398 CTACTGTCTTTGAGGCAAAGTGG - Intergenic
940425341 2:153525347-153525369 CTACTGCTTGAGAAAAACAGAGG + Intergenic
940609778 2:155975398-155975420 CTGTTGTTTTAGAAGAAAAGAGG + Intergenic
940697699 2:157000385-157000407 ATACTCCTTTAAAGGAAAAGTGG - Intergenic
940802989 2:158153889-158153911 CTTCTGCTTTAGAAAAGAAGAGG + Intergenic
941617225 2:167734404-167734426 CTATTGCCTTACAGCAAAAGTGG - Intergenic
944239514 2:197472364-197472386 CTAGTGGTTAAGTGGAAAAGAGG - Intronic
945127475 2:206528671-206528693 CTACTTCTTTAGCTGAAAAATGG - Intronic
945920770 2:215752705-215752727 CTACGGCTTCAGAGGATAGGAGG + Intergenic
946031224 2:216706594-216706616 TTATTGCTTGAGAGGAAAAGAGG + Intergenic
946259159 2:218471212-218471234 CTACTGCGACAGAAGAAAAGAGG + Intronic
947348264 2:229216272-229216294 CTACAGCTGTGGAGGAGAAGTGG + Intronic
947766728 2:232642583-232642605 CTACTGGTTTGGAGGGAAATGGG + Intronic
1168899057 20:1344729-1344751 CTACAGCTTTATAGTAAGAGAGG - Intronic
1170352431 20:15456674-15456696 CTACTGCTCTAGGGAAAATGAGG - Intronic
1171513277 20:25705756-25705778 GTGATGCTTTGGAGGAAAAGAGG + Intergenic
1173115763 20:40241424-40241446 CAACTGACGTAGAGGAAAAGTGG + Intergenic
1177095592 21:16827831-16827853 ATACTGCATTAGAATAAAAGTGG + Intergenic
1177129792 21:17241565-17241587 GTGATGCTTTGGAGGAAAAGAGG - Intergenic
1177254708 21:18645937-18645959 CTACTGTTTTAGAGTAACAAAGG - Intergenic
1183076681 22:35431767-35431789 CTACTCCTTTAGAGTTGAAGGGG + Intergenic
950178090 3:10890174-10890196 TTAGTGCTTTATAGGAAAAAAGG + Intronic
951396610 3:22176665-22176687 CTACTGCTTAAAAGGAAGAAAGG - Intronic
953203085 3:40795252-40795274 GAACTGCTTGAGACGAAAAGAGG + Intergenic
953327053 3:42021111-42021133 ATAATGATTTAGAGGAAAGGTGG + Intronic
953398921 3:42595396-42595418 CTACTAGTTTACAGGAAAAGTGG - Intronic
955482973 3:59407882-59407904 TAACTCCTTTAGAGGAAAAGAGG - Intergenic
956474113 3:69601069-69601091 ATAGGGCTTTAGTGGAAAAGAGG + Intergenic
956966600 3:74468930-74468952 GTACTGCTTTAAAGGGAAAAAGG + Intronic
958862197 3:99457765-99457787 CTTCTGCTTGAGAAGAGAAGAGG - Intergenic
959209542 3:103359708-103359730 CTAATGCATTAGTAGAAAAGGGG - Intergenic
960162105 3:114361732-114361754 CTTCTGCATTTGAGGGAAAGTGG - Intronic
961952239 3:130762217-130762239 CTTCTGCTTGAGGAGAAAAGAGG + Intergenic
962767528 3:138579460-138579482 CTTCTGCTTGAGAAGACAAGAGG + Intronic
963192287 3:142486192-142486214 AAACTTCTTTAGATGAAAAGTGG - Intronic
963583685 3:147157808-147157830 TTGCAGCTTCAGAGGAAAAGAGG + Intergenic
964333884 3:155634392-155634414 CTATTGATTTGGGGGAAAAGAGG - Intronic
964814604 3:160703476-160703498 ATACTGATTTAGAGAAACAGGGG - Intergenic
965167854 3:165219717-165219739 CTTCTAGTTTAGAGGAAAACGGG + Intergenic
965437747 3:168673229-168673251 CTTCTACTTCTGAGGAAAAGAGG + Intergenic
970219325 4:13794626-13794648 CTTCTGCTCCAAAGGAAAAGGGG - Intergenic
970529226 4:16965224-16965246 ATCCAGCTTTATAGGAAAAGTGG + Intergenic
970951488 4:21761737-21761759 TTACTCCTATAGAGGAAGAGAGG + Intronic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
972783444 4:42305965-42305987 CTACAGCACTAGGGGAAAAGAGG - Intergenic
973728482 4:53800245-53800267 CTACTGCCAAAGAGGAAACGAGG + Intronic
974251648 4:59393568-59393590 GTAATGCTTTGGAGGAGAAGAGG + Intergenic
974309590 4:60187711-60187733 CTTCTGCTTGAGAAGAAGAGAGG + Intergenic
974630390 4:64480540-64480562 CTCCTGCTTTAGGAGAGAAGAGG - Intergenic
974713255 4:65630978-65631000 TGACTGCTTAAGAGAAAAAGCGG + Intronic
975653626 4:76619671-76619693 GTAATGGTTTAGAGGAAAAGTGG + Intronic
978470125 4:109056779-109056801 CCAGTGCTTTAGAAGAAAATGGG + Intronic
978603425 4:110452025-110452047 CTACTTCTTGATGGGAAAAGTGG + Intronic
979232185 4:118358448-118358470 CTACTGATTTGGGGGAATAGAGG + Intergenic
979463510 4:121009736-121009758 GTAATGCTTTAGAATAAAAGAGG - Intergenic
981219878 4:142219505-142219527 CCACTGCTTTAGACAATAAGTGG - Intronic
982372986 4:154654792-154654814 CCTCTGCTTTAGTGGAAAACAGG + Intronic
982833484 4:160092535-160092557 CTGCAGCTTTATAGGAAACGAGG + Intergenic
983388868 4:167102959-167102981 TTTCTGCTTGAGGGGAAAAGGGG + Intronic
983922818 4:173365718-173365740 CTCCTGGTTCAGAGGAAATGGGG + Intergenic
984273459 4:177576991-177577013 ATACTGCTTGTAAGGAAAAGTGG - Intergenic
984988494 4:185354354-185354376 CTACTGCTCAAGAGGAAAAAAGG - Intronic
987659243 5:20851066-20851088 CAACAGCTTTAGGGTAAAAGTGG - Intergenic
988169799 5:27639067-27639089 CTTCTGCTTGAGAAGAAGAGAGG - Intergenic
988295951 5:29362312-29362334 GAACTTCTTTAAAGGAAAAGAGG - Intergenic
988764427 5:34354916-34354938 CAACAGCTTTAGGGTAAAAGTGG + Intergenic
989582922 5:43050316-43050338 TTACTGCTTCAAAAGAAAAGAGG + Intergenic
992672591 5:79075079-79075101 CTGCTACTGTAGTGGAAAAGTGG + Intronic
992710795 5:79453614-79453636 CTAGTCCTTTTAAGGAAAAGAGG + Intronic
993871033 5:93254226-93254248 CTACTGGTTTAGAAGGAAAATGG - Intergenic
994212927 5:97106236-97106258 CAAGTGCTTTTGAGGAAGAGAGG - Intronic
995256935 5:110057685-110057707 CTACTCCTTTATATGAAAAATGG - Intergenic
998540421 5:142976362-142976384 CTACTGCTTCTGAGGGACAGGGG + Intronic
1000757278 5:165176817-165176839 CTACTGATTTACGGAAAAAGAGG - Intergenic
1003488955 6:6604571-6604593 CTACAGCTATAGAAGAAAATAGG + Intronic
1003939953 6:11014584-11014606 CTACTGCTGGAGAGGCAAGGAGG - Intronic
1003940415 6:11019634-11019656 CTACTGCTGGAGAGGCAAGGAGG + Intronic
1007814583 6:44512141-44512163 CTACTGGTTTTGAGGATAAATGG + Intergenic
1010299999 6:74248746-74248768 CTACTTCTTTAGAAGGCAAGTGG + Intergenic
1010838001 6:80613195-80613217 GTGATCCTTTAGAGGAAAAGAGG - Intergenic
1011229121 6:85140045-85140067 CAAGTGCTGTAGAGGCAAAGAGG - Intergenic
1011997569 6:93612537-93612559 GTAGTGCTTTAGATGAAATGAGG + Intergenic
1012002412 6:93669283-93669305 ATATTGCTTTGGAAGAAAAGTGG + Intergenic
1012640585 6:101606811-101606833 TTCCTGCATTAGAGGAAAAATGG + Intronic
1012678875 6:102153738-102153760 CTTCTGCTTGAGAAGAAAAGAGG + Intergenic
1015018641 6:128444516-128444538 CTATTGCAATAGAGGGAAAGAGG - Intronic
1015107520 6:129554284-129554306 CTACTGCTTAAAAGGAAATAAGG + Intergenic
1017989948 6:159477926-159477948 CAAATTCTTTAAAGGAAAAGTGG - Intergenic
1018741546 6:166732931-166732953 CTGCTGGCTTAGAGGAAATGAGG + Intronic
1020662309 7:10996404-10996426 CTAGTACTTTAGAGGAGATGGGG + Intronic
1023252165 7:38276483-38276505 TTACTGCCTTAGAAGAAAACAGG - Intergenic
1023344395 7:39256399-39256421 CTAATTCTTTAGGGGGAAAGAGG + Intronic
1026644109 7:72153073-72153095 TGACTGATTTATAGGAAAAGTGG - Intronic
1027630492 7:80598547-80598569 CTACTCCTTTGGGGAAAAAGTGG - Intronic
1028575917 7:92350271-92350293 CTACAGCTTTAAAGAAAAGGGGG - Intronic
1028612200 7:92724294-92724316 CCATTGCTTTAGAGGAGAAATGG - Intronic
1031144994 7:117987661-117987683 ATACAGCTTTAGAAGAGAAGAGG + Intergenic
1031634613 7:124086753-124086775 CTACCACTTTAGACGAATAGAGG + Intergenic
1031689022 7:124765593-124765615 CTACTGCTGCCGAGGAGAAGCGG + Exonic
1031764925 7:125766032-125766054 ATAATGCTTTTGAGGAGAAGGGG - Intergenic
1032592603 7:133206026-133206048 CTTCTGTTTTAGAGGAAAAGTGG + Intergenic
1033610417 7:142959213-142959235 CAACTGGTATAGAGGCAAAGAGG + Intronic
1038436473 8:27540109-27540131 TTCCTGCCTTAGAGGAAAAACGG + Intronic
1038718116 8:30009844-30009866 CAAATGCTTTCCAGGAAAAGAGG + Intergenic
1039431104 8:37525768-37525790 CCCCTTCTTTAGTGGAAAAGGGG + Intergenic
1040626896 8:49159748-49159770 CTAATGCTTTTGTGGGAAAGAGG + Intergenic
1041290970 8:56308165-56308187 CTAATGCTTTTGAAGCAAAGTGG - Intronic
1041403324 8:57468182-57468204 CTATTGTTTTAGAGTAAAAGAGG + Intergenic
1044520150 8:93189621-93189643 CTGGAGCTTTGGAGGAAAAGAGG + Intergenic
1045809040 8:106200365-106200387 CTACCTCTTTAGAGGCAAAGAGG - Intergenic
1048648185 8:136445442-136445464 CTATAGCTTGAGAGGAAAATGGG - Intergenic
1049045247 8:140145287-140145309 CTACTGCAATAGGGAAAAAGAGG - Intronic
1051865983 9:21683245-21683267 CGGCTGCTTTAAAGGAAAGGTGG + Intergenic
1052539338 9:29787788-29787810 CTACTGCTTTATAGCACAAAAGG + Intergenic
1053079546 9:35162844-35162866 TGACTGCTTTTGAGGATAAGAGG + Intronic
1055580022 9:77698670-77698692 CTTCTGCTTGAGAAGAGAAGAGG - Intergenic
1056979644 9:91297517-91297539 CTTCCTCTTTAGAGGAAATGGGG - Intronic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1057845312 9:98518153-98518175 CAACTGCTCTGGAGGACAAGGGG - Intronic
1058110506 9:101027569-101027591 CCTCTGCTTTGGAGGAATAGAGG - Intergenic
1186194112 X:7094666-7094688 CTGATACTTTAAAGGAAAAGGGG + Intronic
1186358097 X:8808433-8808455 CCACTATTTTAGAGGAACAGTGG - Intergenic
1186570834 X:10713263-10713285 CCACTGCTTTAGCTGAAAAGTGG + Intronic
1186949492 X:14607671-14607693 TTAGTGCCTTAGTGGAAAAGAGG + Intronic
1189885502 X:45540379-45540401 CAAATGCTTTATGGGAAAAGAGG - Intergenic
1190258113 X:48779814-48779836 CCGCTGCTTTAGAAGAAAACAGG + Intergenic
1191071912 X:56410075-56410097 CTGATCCTTTGGAGGAAAAGAGG + Intergenic
1193060035 X:77196514-77196536 GTAATCCTTTAGAGGAGAAGAGG + Intergenic
1195387981 X:104331316-104331338 CTACTGCTGAAGAGGAATAGAGG - Intergenic
1195438223 X:104870311-104870333 CTCTTGCTTTTGAAGAAAAGTGG + Intronic
1197493768 X:127152817-127152839 ATATTGCTCTAGATGAAAAGAGG - Intergenic
1197979647 X:132201928-132201950 CCACTCCTTTAGTGGAAAAAAGG + Intergenic
1198397113 X:136231338-136231360 TTTCAGCTTTGGAGGAAAAGTGG + Intronic
1202299095 Y:23392024-23392046 TTACTGTTTTGGAGAAAAAGTGG + Intergenic
1202571714 Y:26278574-26278596 TTACTGTTTTGGAGAAAAAGTGG - Intergenic