ID: 934098445

View in Genome Browser
Species Human (GRCh38)
Location 2:88628464-88628486
Sequence TCAACGAGGAGGAGACTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934098445 Original CRISPR TCAACGAGGAGGAGACTGGC CGG Intergenic
902896765 1:19485102-19485124 TCACCGAGGGGGTGCCTGGCTGG + Intronic
903950330 1:26992944-26992966 TTAAAGAGGGGGAAACTGGCCGG - Intergenic
904271557 1:29353623-29353645 TTAAAGATGAGGTGACTGGCCGG + Intergenic
904477701 1:30775559-30775581 TCCACGAGGACCAGCCTGGCAGG - Intergenic
906860480 1:49353726-49353748 TCCACGAGCAGAAGAGTGGCAGG + Intronic
911070189 1:93826164-93826186 TCAAGGAGGAGGGCACTGTCTGG + Intronic
912562953 1:110563432-110563454 TCATGGAGGAGGAGACTGTGTGG + Intergenic
913048149 1:115090433-115090455 TCAACAATGAGGAGACAGCCAGG + Intergenic
915901365 1:159848786-159848808 TCAAAGAGGAGCACACAGGCCGG + Intronic
916065137 1:161130711-161130733 TTAATGAGGAGGAGAATGCCAGG - Intronic
919756432 1:201069022-201069044 GAAAAGAGGTGGAGACTGGCAGG - Intronic
920418492 1:205813802-205813824 TGAAAGGGGTGGAGACTGGCGGG + Intergenic
920653964 1:207860904-207860926 GCAAGGAGGAGGGGACAGGCTGG + Intergenic
922752492 1:228077124-228077146 TCACCCAGGAGGAGCCCGGCAGG + Intergenic
1063204314 10:3816097-3816119 TCCACGATGAAGACACTGGCAGG - Intergenic
1064145662 10:12824205-12824227 TCAACCAGGAGGGCGCTGGCGGG + Intronic
1069242184 10:66156744-66156766 TTAATGAGGTGGAGACTGGTAGG + Intronic
1072300906 10:94061084-94061106 TCAGCGAGGAGGAAACTGTGGGG + Intronic
1072596626 10:96878548-96878570 CCAAGAAGGAGGAGACTGGGTGG + Intronic
1072792583 10:98329103-98329125 TCAAAGAGCAGGAAAGTGGCTGG + Intergenic
1073174770 10:101548217-101548239 TCAACTAGGAGTAGACTTGCTGG - Intronic
1076124821 10:127965798-127965820 AGAAAGAGGTGGAGACTGGCTGG - Intronic
1077239728 11:1504199-1504221 AGAACGGAGAGGAGACTGGCAGG + Intergenic
1078184424 11:9039712-9039734 TCACAGAGATGGAGACTGGCTGG - Intronic
1078654833 11:13229033-13229055 GCAAAGAGAAGGAGACTGGCAGG + Intergenic
1079212972 11:18479998-18480020 TCAAAAAGGAGCAGAGTGGCAGG - Intronic
1079251273 11:18790021-18790043 TCACCTTGGAGGAGACTGGATGG - Intronic
1079689930 11:23405870-23405892 TCACCAGGGAGGGGACTGGCCGG - Intergenic
1081884533 11:46483602-46483624 TTAAAAAGGAGGAGGCTGGCAGG + Intronic
1083833220 11:65246817-65246839 GCAAGGAGGCCGAGACTGGCTGG + Intergenic
1089079998 11:115767632-115767654 TCAACGATCAGCAGAGTGGCAGG - Intergenic
1090236512 11:125152260-125152282 TCAAAGAAGAGGAGCCTGCCAGG - Intergenic
1090427563 11:126619318-126619340 TCAACTAGGGGGAGAATGGGAGG + Intronic
1091172211 11:133529258-133529280 TCACCTAGGAGGAGAGAGGCAGG - Intronic
1091678851 12:2511739-2511761 TGAGCAAGGAGGAGGCTGGCAGG - Intronic
1092246625 12:6867690-6867712 TCGCCGAGGAGGGGTCTGGCCGG + Intronic
1094264772 12:28544189-28544211 TTACCAAGGAGGAGACTGGTAGG - Intronic
1099075141 12:78097147-78097169 TCAGCAATGAGGAGACTGCCTGG + Intronic
1102739479 12:115194492-115194514 AGAAGGAGGAGGAGAATGGCCGG + Intergenic
1104569741 12:129914756-129914778 TGATGGAGGAGGAGCCTGGCTGG - Intergenic
1104666437 12:130650398-130650420 GCAACGAGCAGAAGGCTGGCTGG - Intronic
1104892551 12:132147524-132147546 CCAACCAGGAGGAGTCTGCCTGG + Intronic
1104937340 12:132373302-132373324 TCCAGCAGGAGGAGACTGGCTGG + Intergenic
1110370520 13:74734926-74734948 TCACGGAGGAGGGGACTGGTGGG + Intergenic
1117191345 14:53294970-53294992 TCCACCAGGAGGAGACTATCTGG + Intergenic
1117243830 14:53863488-53863510 TCTTTGAGGAGGAGACTGGTAGG - Intergenic
1119576492 14:75728057-75728079 TTAAAGAGGAAGAAACTGGCTGG + Intronic
1119783485 14:77295334-77295356 TTAAAGAGGAGGATACAGGCTGG + Intronic
1120741892 14:88117845-88117867 TGGACCAGGAGGAGCCTGGCAGG - Intergenic
1121144673 14:91573858-91573880 GCAGGGAGGAGGAGGCTGGCAGG + Intergenic
1121144684 14:91573895-91573917 GCAGGGAGGAGGAGGCTGGCAGG + Intergenic
1121144695 14:91573932-91573954 GCAGGGAGGAGGAGGCTGGCAGG + Intergenic
1122686676 14:103511528-103511550 TCCAAGAGGAGGAGACTGCCAGG - Intergenic
1123090350 14:105739541-105739563 ACAACGTGGAGGAGAGTGTCGGG + Intergenic
1202904449 14_GL000194v1_random:60198-60220 TCCAGGAGGAGGGCACTGGCCGG - Intergenic
1126112887 15:45186045-45186067 TTAGAGAGGAGGAGACTGACTGG + Intronic
1126733682 15:51710312-51710334 TGAAAGAGGAGGAGAATGACGGG + Intronic
1127284641 15:57521823-57521845 TCTAAGAGGAGGAGAAAGGCTGG + Intronic
1131379789 15:91954372-91954394 TCAGCCAGGCGGAGACGGGCGGG + Intronic
1131982445 15:98007528-98007550 GCAAAGAGCAGGAGACAGGCAGG + Intergenic
1132574875 16:659701-659723 TCACGGAGGAGGAGGCTGGCAGG + Intronic
1133602820 16:7356489-7356511 TGATGGAGGAGGAGCCTGGCAGG + Intronic
1134084832 16:11349252-11349274 TCGAAGAGGAGGAAGCTGGCAGG + Intronic
1134485897 16:14658159-14658181 TCCAAGAGGAAAAGACTGGCAGG + Intronic
1135461352 16:22646152-22646174 TGAATGAGGGAGAGACTGGCAGG - Intergenic
1136230175 16:28881079-28881101 TGGAGGAGGAGGAGACTGGAGGG - Intronic
1136609946 16:31360132-31360154 TCCACGAGAAGGGGACAGGCAGG + Intronic
1137866181 16:51899024-51899046 TCATCAAGGGGAAGACTGGCAGG - Intergenic
1139789855 16:69424850-69424872 TCAACGAGGTGGGGCCTGGGAGG + Exonic
1143130382 17:4673619-4673641 TCATCAAGGAGGAGACTCACAGG - Exonic
1143590286 17:7881925-7881947 TCAGGGAGGAGCAGACAGGCAGG + Intronic
1143654889 17:8288456-8288478 TCAATCAAGAGGAGGCTGGCGGG + Exonic
1147235317 17:39052892-39052914 TCAGCCAGTAGGAGAGTGGCCGG - Intergenic
1150658609 17:67056658-67056680 TCACCGAGAAAGAGACAGGCTGG - Exonic
1151986764 17:77548677-77548699 TCAAGGTGGAGGAGTTTGGCTGG + Intergenic
1156356047 18:36340931-36340953 TCAAAGAAAAGGAGACTGGCCGG - Intronic
1157514436 18:48300812-48300834 ACAACGAGAAGGACACTGCCAGG + Intronic
1158699382 18:59732749-59732771 TTATCCAGGAGAAGACTGGCAGG - Intergenic
1161865548 19:6829675-6829697 CCAAGGAGGAGGAGAAGGGCAGG + Intronic
1162145020 19:8608264-8608286 TCAAAGAGGAGGAGCCGGGCTGG + Exonic
1164571702 19:29379475-29379497 TCTCCGAGGAGGCGACTTGCAGG - Intergenic
1165740982 19:38205170-38205192 AGGATGAGGAGGAGACTGGCTGG + Intronic
1166348893 19:42184636-42184658 TTAGCAAGGAGGAGACTGTCAGG - Intronic
1167638894 19:50669304-50669326 TCAAGGAGGGGGACCCTGGCGGG + Intronic
1167995089 19:53395521-53395543 CCAACGAGGGCGAGACTGGGAGG - Intronic
928094498 2:28395309-28395331 TCAGGGAGGAGGAGACAGACAGG - Intronic
932569249 2:72929352-72929374 TGAAAGAGGAGGAGACAGGGAGG + Intronic
932659910 2:73642801-73642823 TCAGCGAGGAGAAGCCTAGCTGG - Intergenic
932695347 2:73951686-73951708 CCAACGAGGAGAGGACTGGAAGG + Intronic
932896432 2:75645265-75645287 TCATCCAGGAGGAGACAGGGAGG + Intergenic
933373524 2:81448094-81448116 GCAACGAGGAGGAGTATGGAAGG - Intergenic
934098445 2:88628464-88628486 TCAACGAGGAGGAGACTGGCCGG + Intergenic
934502191 2:94870201-94870223 TCCAGGAGGAGGGCACTGGCCGG + Intergenic
936153410 2:110033691-110033713 TGAATGAGGAGGAGGCAGGCTGG - Intergenic
936191271 2:110337724-110337746 TGAATGAGGAGGAGGCAGGCTGG + Intergenic
937960133 2:127452200-127452222 TCAAGGAGGAGGGGACTGCCAGG - Intronic
938745696 2:134276173-134276195 TAAATGAGGTGGAGATTGGCGGG - Intronic
944742834 2:202629083-202629105 TGAAAGAGGAGCAGAATGGCGGG + Intergenic
945959209 2:216114626-216114648 TCATCGAGGGGAAGACAGGCGGG + Intronic
947223881 2:227821675-227821697 TCAAAGAGCAGGAGAATGGGAGG + Intergenic
1169801817 20:9518430-9518452 TAAACGGGGAGGAGGCTGGGAGG - Intronic
1171405916 20:24912474-24912496 TCAAAGAGGAGGAGGCTTCCAGG - Intergenic
1172052873 20:32132534-32132556 TGAGCGAGGAGGAGAGTGGGAGG + Intronic
1173260450 20:41430380-41430402 TCAATTAGGAGGACACTGGAGGG - Intronic
1173654562 20:44690690-44690712 TCATGGTGGAGGAGGCTGGCGGG + Intergenic
1175163899 20:57029558-57029580 TCAAGGGGCAGGAGGCTGGCAGG + Intergenic
1175459381 20:59140380-59140402 TCAACCAGGAGCAGACTCTCTGG - Intergenic
1175568278 20:59998279-59998301 TGAGCTTGGAGGAGACTGGCAGG + Intronic
1176196395 20:63838142-63838164 TGGCCGAGGAGGCGACTGGCAGG + Intergenic
1176623819 21:9074965-9074987 TCCAGGAGGAGGGCACTGGCCGG - Intergenic
1178580802 21:33836525-33836547 TCAACAAGGAGGACCCTGACTGG + Exonic
1178947800 21:36962490-36962512 TTAAAGATGAGGAGGCTGGCCGG + Intronic
1180228915 21:46414628-46414650 TCCAGGAGGAGGAGAGTGGGCGG - Intronic
1180228955 21:46414784-46414806 TCCAGGAGGAGGAGAGTGGGCGG - Intronic
1180735395 22:18012605-18012627 TCCTGCAGGAGGAGACTGGCTGG - Intronic
1183987410 22:41577138-41577160 GCCACTAGGAGCAGACTGGCTGG + Exonic
950442203 3:13016572-13016594 GCACAGAGGAGGAGGCTGGCAGG - Intronic
952461927 3:33536541-33536563 TGAACAAGGAGGAAACTAGCAGG + Intronic
954389565 3:50261521-50261543 TCAGTGAGGAGGAGCCAGGCAGG + Intergenic
954457870 3:50609736-50609758 TCAAGGAGAACCAGACTGGCTGG + Intronic
968535464 4:1125036-1125058 TCAAGGAGCAGCAGAATGGCTGG + Intergenic
968893995 4:3388191-3388213 TCACAGAGGAGGAGACGGGAGGG + Intronic
969467434 4:7366136-7366158 CCAAGGAGGAGGAGGGTGGCAGG - Intronic
969485035 4:7467413-7467435 TCAAGGAGGTGGCGACTGCCAGG + Intronic
970492801 4:16592101-16592123 TCAACAAGAAAGAGGCTGGCAGG + Intronic
971156741 4:24091467-24091489 TCAGCGAGAAGCAGGCTGGCAGG - Intergenic
980970257 4:139560599-139560621 GCAGCGAGGAGGAGACGGGTGGG + Intronic
983124853 4:163938361-163938383 TCAGCAATGAGGTGACTGGCTGG + Intronic
986396107 5:7332306-7332328 TCACAGAGGAAGAGACTGGGGGG + Intergenic
986453336 5:7889257-7889279 TCACCGAGCAGGAGACTGAGTGG - Exonic
992269065 5:75047427-75047449 TCTTGGAGGAGGAGAGTGGCTGG + Intergenic
993710016 5:91215296-91215318 GCAATGGGGAGGAGACTGGGAGG + Intergenic
994029512 5:95125471-95125493 TCAACAACAAGGAGACTGCCAGG - Intronic
995240769 5:109883867-109883889 TCAACGGGGAGGCGATAGGCTGG - Exonic
997125591 5:131223891-131223913 TCAACATGGAGGACACTTGCTGG - Intergenic
998354619 5:141524728-141524750 TCTAAGAGGAGCAGCCTGGCTGG + Intronic
1000848753 5:166313876-166313898 CCACCAAGGAGGAGCCTGGCAGG + Intergenic
1001838224 5:174850614-174850636 TCAAGGAAGAGAAGACTGGGGGG - Intergenic
1002020332 5:176360502-176360524 TTAAAGAGAAGGAAACTGGCCGG + Intronic
1005068795 6:21845093-21845115 GGAAGGAGGGGGAGACTGGCTGG - Intergenic
1005475622 6:26204793-26204815 TCATCTACGAGGAGACTCGCGGG + Exonic
1005514243 6:26538844-26538866 TTAAAGAGGTGGTGACTGGCAGG + Intronic
1005643999 6:27824273-27824295 TCATCTACGAGGAGACTCGCGGG + Exonic
1005645198 6:27831357-27831379 TCATCTACGAGGAGACTCGCGGG - Exonic
1006614911 6:35319555-35319577 TGAAGGAGGAGGAGGCTGCCCGG + Exonic
1006851569 6:37102497-37102519 TCCCCGAGGTGGAGACTGGGTGG + Intergenic
1007829062 6:44624500-44624522 TGAAGGAGGAGGGGGCTGGCGGG + Intergenic
1023458507 7:40367915-40367937 TGAAGGAGGAGGAGAATGGTGGG - Intronic
1023967696 7:44971583-44971605 GGGATGAGGAGGAGACTGGCTGG - Intronic
1026493544 7:70883668-70883690 CCAAAGGGGAGGAGACTGGGAGG - Intergenic
1026568067 7:71506211-71506233 TCAAACAGGAGGACACTAGCTGG + Intronic
1026635354 7:72077227-72077249 TCAAACAGGAGGACACTAGCTGG + Intronic
1029110782 7:98212165-98212187 TCAGCAAGGAGGAGGCTGCCAGG + Intronic
1029293759 7:99522865-99522887 GCAAGGAGGAGCAGACAGGCTGG + Intronic
1031135152 7:117875767-117875789 TCCACCAGGAGGACACTTGCTGG + Intergenic
1032476493 7:132214746-132214768 TCACCCAGCAGGAGTCTGGCTGG + Intronic
1035373229 7:158392231-158392253 TCCCCGAGGAGGAGAGGGGCTGG + Intronic
1037806290 8:22059460-22059482 TCAACGAGCAGGACTCTGGGTGG + Exonic
1038094639 8:24294168-24294190 ACAGAGAGGAGGAGACTGACTGG - Exonic
1038419057 8:27420449-27420471 TCAACAGGGAGGTGGCTGGCAGG - Intronic
1039346613 8:36712116-36712138 TCGACCAGGAGCAGGCTGGCTGG - Intergenic
1039424922 8:37477754-37477776 GCAAGGAGGTGGAGTCTGGCAGG - Intergenic
1043020198 8:74990707-74990729 TCAACAACAAAGAGACTGGCGGG - Intronic
1044621926 8:94199002-94199024 TCTGAGAGGAAGAGACTGGCTGG - Intronic
1046883494 8:119337035-119337057 CCTATGAGGAGGAGTCTGGCAGG - Intergenic
1047256327 8:123216105-123216127 TCAAAGTGGAGGTGACTGGATGG + Intergenic
1047391403 8:124454739-124454761 TAAAAGAGGAGATGACTGGCTGG - Intronic
1048590204 8:135814291-135814313 TCAGTGAGGAGGATACTGCCTGG - Intergenic
1049181597 8:141225854-141225876 GCAAAGGGGAGGAGGCTGGCGGG - Intronic
1049497706 8:142944258-142944280 ACAATGAGGAAGAGTCTGGCAGG - Intergenic
1051180363 9:14405428-14405450 GCAACGAGGATGTGAATGGCAGG + Intergenic
1051365459 9:16318627-16318649 TCACCGGGGAGGTGAATGGCTGG + Intergenic
1056704066 9:88936835-88936857 TCATGGAGGAGGAATCTGGCAGG + Intergenic
1058061340 9:100499901-100499923 TCAACCATGAAGAAACTGGCTGG - Intronic
1058895195 9:109394841-109394863 ACAAAGAGGAAGAAACTGGCCGG + Intronic
1060008062 9:120018010-120018032 TCAAAGAGAATGAGACAGGCAGG + Intergenic
1061349004 9:130049073-130049095 TTAAAGAAGAGGAAACTGGCCGG - Intergenic
1203747004 Un_GL000218v1:45393-45415 TCCAGGAGGAGGGCACTGGCCGG - Intergenic
1203563099 Un_KI270744v1:74087-74109 TCCAGGAGGAGGGCACTGGCCGG + Intergenic
1186049839 X:5579556-5579578 TTAACTAGGAGGTGTCTGGCTGG + Intergenic
1186730228 X:12402121-12402143 AGAAGGAGGAAGAGACTGGCTGG + Intronic
1187468088 X:19543748-19543770 TGAAGGTGGAGGAGACTGGCGGG + Intronic
1188700286 X:33251342-33251364 ACAAAGAGGAGGAAACTGGATGG - Intronic
1190248714 X:48706993-48707015 TTATCAAGGAGGGGACTGGCTGG - Intronic
1192233000 X:69278619-69278641 GCAAAGAGGAGGTGACAGGCAGG - Intergenic
1197199089 X:123733179-123733201 CCAACGACGTGGAGACTCGCGGG + Intergenic