ID: 934099373

View in Genome Browser
Species Human (GRCh38)
Location 2:88637978-88638000
Sequence AATTATAAGCAAAAAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934099369_934099373 9 Left 934099369 2:88637946-88637968 CCCTACCATTTTCTCTCTTGAGA No data
Right 934099373 2:88637978-88638000 AATTATAAGCAAAAAGTGCAGGG No data
934099371_934099373 4 Left 934099371 2:88637951-88637973 CCATTTTCTCTCTTGAGACATTT No data
Right 934099373 2:88637978-88638000 AATTATAAGCAAAAAGTGCAGGG No data
934099370_934099373 8 Left 934099370 2:88637947-88637969 CCTACCATTTTCTCTCTTGAGAC No data
Right 934099373 2:88637978-88638000 AATTATAAGCAAAAAGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934099373 Original CRISPR AATTATAAGCAAAAAGTGCA GGG Intergenic
No off target data available for this crispr